Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
Keyword Tenders
»
Protein Powder
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of protein-powder Tenders

List of latest protein-powder Tenders in Indian Tenders. Click on any protein-powder Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for protein-powder Tenders.

Advance Search
  • All-Tenders (18)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
1 Panchayat Division
image image
State Government
TRN :35629542 |  28 Oct, 2025
Tender Value : 10.20 Lacs
 Kolhapur - Maharashtra
Tender for gem bids for steel hand wash station, protein powder, hand gloves, hand sanitizer, hand wash station steel, water purifier
  • View Tender
  • Document
  • Bid Support
2 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35631048 |  05 Nov, 2025
Tender Value : 21.34 Lacs
 Nainital - Uttaranchal
Tender for gem bids for anti rainbow trout oncorhynchus mykiss atlantic salmonsalmo salar igm monoclonal antibody lyophilized proteinprepared from bovine free tmb elisa substratesolutionsturbo250 ml per pack bovine serum albuminbsa protease free fatty acid free ph 7 0 50 grams per pack goat anti mouse igg h l secondary antibody hrpconjugated lyophilized polyclonal 2ml per vial hydroxylamine hydrochloride hi ar acs n 1 naphthylethylenediamine dihydrochloride hi ar acs nedd 2phenoxyethanol vanadium iii chloride sodium nitrite sodium nitrate hi lr hydrochloric acid concentrated sodium hypochlorite hi ar acs 4 w v solution ezassaytbars estimation kit for lipid peroxidation 100 reactions ezassaytm reactive oxygen species assay kit frap 200tests agarose low melting field test kit dneasy bloodand tissue kit 50 50 dneasy mini spin columns proteinasek buffers collection tubes 2 ml hematoxylin solution500ml eosin y solution 0 5 alcoholic 500ml histosec 60pastilles without dmso oxolinic acid iodophor chloramine t trihydrate potassium permanganate bhuvision soil nutrient analysis code hg bsna 100 test clearserological pipette 10ml amber glass vials ermamicrotome blades 1 2 propanediol 2 5l erlenmeyerconical flask multi port hplc cap micropipette weigert s iron hematoxylin kit 2x500ml eosin y 5g alcianblue 8gx 10g d p x 100ml paraplast plus 1kg 30acrylamide bis solution 29 1 l thick blot filter paper precut prestained protein ladder methanol glycerol biotin dsorbitol g418 disulfate salt potassium phosphate dibasic potassium phosphate monobasic ptriex 4 neo dnanovagen amicon ultra centrifugal filter 10 kda mwco ampicillin sodium salt imidazole dmso protease andphosphatase inhibitor cocktail tmb enhanced one bid number gem2025b6792045 dated 15-10-2025 bid document1 93 0 0 component hrp membrane substrate, 3 3diaminobenzidine, ammonium persulfate, cobalt iichloride, yepd broth granulated 500g, ypd yepd growthagar 500g, ypd yepd growth medium, yeast nitrogenbase ynb w ammonium sulphate 100g, peptone 500g, yeast extract powder, l histidine, dextrose anhydrous hiar acs, l glutamic acid, l methionine, l lysine hi lr, lleucine, l isoleucine, 10x tris glycine sds gel runningbuffer, 2 5x tris sds buffer ph 8 8, 5x tris sds buffer ph 68, 10x transfer buffer, 5x laemmli buffer, 50x tae, rnaisolation, sedgewick rafter counting chamber cell, borosilicate bod bottles, borosilicate dissolved oxygenbottles, uniflo 13mm 0 2 pes s 100 pk, uniflo 13mm 045 pes s 100 pk, uniflo 25mm 0 45 pes s 45 pk, uniflo25mm 0 2 pes s 45 pk, single tubes pcr 0 2 ml transparentwith attached flat cap, microcentrifuge tubes pp 0 5 ml withattached cap with lid closure, microcentrifuge tubes pp 1 5ml with attached cap with lid closure, microcentrifuge tubespp 2 0 ml with attached cap with lid closure, microcentrifuge tubes pp 5 ml transparent, mueller hintonagar granulated 500g, mueller hinton broth 500g, glucose yeast extract agar 500g, glucose yeast extractacetate broth 500g, agar granulated bacteriological grade500g, nutrient agar granulated, nutrient broth granulated, d glucose anhydrous, sodium chloride, xylene forhistopathology 2 5l, resazurin sodium salt 5g, z 2 cl osu100g, mtt 1g, n phenyl 1 naphthylamine 500g, propidium iodide, wizard genomic dna purification kit 100isolations x 300ul, wizard sv gel and pcr cleanup system50 prep, hepes molecular biology grade free acid 100g, disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg, petridish, centrifuge tube conical bottom with lid, selfstanding centrifuge tube with lid, cryovial with externalthreaded self standing sterile, cryo box pp, rack for microtube l, rack for micro tube, universal tube rack pp, universal tube rack, 20c mini cooler with gel filled cover, 0c mini cooler with nontoxic gel, agar powderbacteriological grade, mueller hinton agar, mueller hintonbroth, tryptone soya broth soyabean casein digestmedium, tryptone soya agar casein soyabean digest agarsoyabean casein digest agar, steriswift disinfectant wipes, polyethylene glycol mw 6000, sterile cotton swab, 2 10ulaerosol barrier gentip, 20 200ul aerosol barrier gentip, 100 1000ul aerosol barrier gentip, wrappup alluminiumfoils, biosoft tissue, kimwipes, kimberly clark, ecosafedisinfectant, centrifuge tube, petri dish, syringe
  • View Tender
  • Document
  • Bid Support
3 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35618730 |  04 Nov, 2025
Tender Value : 3.11 Lacs
 Hazaribagh - Jharkhand
Tender for gem bids for bp dna ladder dye plus, 50 bp dna ladder dye plus, 10bp dna ladder dye plus, rnase a 50 mg, proteinase k100 mg, tris acetate edta buffer tae 50x powder ph8 3, tris borate edta buffer tbe powder ph8 3, tris edtabuffer te 10x powder ph7 4, 6x loading dye, rnase freewater 1000 ml, dna off dna destroys agent surfacclining, ethidium bromide, tween 20, edta disodiumsalt, edta, sodium dodecyl sulfate sds, phenol, ethanolmb grade, mercaptoethanol, polyvinylpyrrolidone pvp, chloroform ar acs grade, sodium acetate, sulphuric acidar acs grade assay min 98 pack of 2 5 ltr in glass bottlenabl iso iec 17025 2017 certificate required, nitric acidar acs grade assay 68 70 pack of 2500 ml in glass bottlenabl iso iec 17025 2017 certificate required, ammoniummolbdate ar grade assay min 99 pack of 250 g, dimethylsulphoxide dmso ar grade 99 pack of 500ml, tris bufferar acs 99 9 pack of 500g, tris hydrochloride tris hclassay 99 pack of 500g, sodium chloride acs grade assay99 9 pack of 500g, perchloric acid 70 ar acs grade assaymin 70 pack of 500 ml in glass bottle nabl iso iec 170252017 certificate required, agarose molecular biology gradewhite to off white powder moisture content 8 gel strengthg cm2 1200 min dnase rnase protease none detected packof 500g, cetyltrimethyl ammonium bromide ctab assay 99pack of 500 g, phenol chloroform isoamyl alcohol 25 24 1ph 8 0, fe hedta n 2 hydroxyethylethylenediaminetriacetic acid extrapure 99 iron fe content12 14 pack of 500 g, isopropanol acs grade assay 99 5pack of 1 ltr, tris saturated phenol ph 8 mb grade dnasernase protease not detect pack of 100ml, pcr gradeextrapure mgcl2 25 mm pack of 10 ml, taq dnapolymerase 10x buffer with mgcl2 5u ul 5000u thepolymerase is supplied with separate tubes of buffer mg2plus and dntps pack of 250ulx20, tris buffer ar acs formolecular biology 99 9 assay 99 9 pack of 1kg, sodiumhydroxide naoh acs grade, dithiothreitol dtt if workingwith protein sensitive dna extractions
  • View Tender
  • Document
  • Bid Support
4 Security Services
image image
Central Government/Public Sector
TRN :35619158 |  24 Oct, 2025
Tender Value : 0
 Varanasi - Uttar Pradesh
Tender for gem bids for budesonide 05mg respules budesonide 500 mcg plusformoterol 20 mcg respules budesonide bp 160 mcg plusformoterol fumarate 45 mcg dry powder multi unit doseinhaler 60 doses inhaler cabergoline 05 mg tab calamine 100 ml lotion calamine powder packet of 400gm calcium plus vit d3 200ml bott syp calcium acetate667 mg tab calcium dobesilate 500 mg tab canagliflozin100 mg tab candid mouth paint clotrimazole lansoprazole 30 plus clarithromycin 250 mg plus tinidazole500 mg tab silodol 8 mg plus dutasteride 05 cap capacetabine 500 mg tab carbamazepine 200 mg cr tab carbamazepine 200 mg tab carbidopa 10 mg pluslevodopa 100 mg cr tab carbidopa 25 plus levodopa 250mg tab carbidopa 25 mg plus levodopa 100 mg cr tab carbimazole 5mg tab caroverin 20 mg cap carvedilol125 mg tab carvedilol 625 mg tab cefixime 200mgplus clavulanate 125 mg tab cefpodoxime 200mg plusclavulanate 125 mg cap cefuroxime 500mg plusclavuclonic acid 125 mg tab cerebroprotein hydrolysate90 mg tab cervical collar size l cervical collar size m cervical collar xl cetrizine 5mg plus paracetamol 325mgplus phenylephrine hcl 5mg tab chloramphenical pluspolymaxin b sulphate plus dexa 5ml bott eye drop chlordiazepoxide 10 mg tab chlordiazepoxide 5 mg plusclidinium bromide 25 mg librax 5 plus 25 tab chlorhexidine mouth wash 2 percentage bott of 100 mllotion chlorthalidone 125 mg tab chlorthalidone 625mg tab cholesterol kit lab oint choline salicylate 87percentage plus lidocaine 2 percentage cilnidipine 10 mgtab cilnidipine 20 mg tab cilnidipine 5 mg tab cilostazol 100 mg tab cinnarizine 25mg tab cinnarizine75 mg tab clarithromycin 250mgtab clarithromycin 500mg tab oint clindamycin 1 percentage plus adapalene 01 bid number gem2025b6759675 dated 14-10-2025 bid document1 109 1 1 pearcentage plus aloe allantoin gel tube, clindamycin1percentage gel 10 gm, clindamycin 300 mg cap, foleyscatheter 2 way size 18 f misc, folic acid 5 mg tab, forglyn formoterol 6mcg plus glycopyrrolate 25mcgrotacap, formetrol 6mcg plus budesonide 200mcg inhaler, formoterol 12mcg plus budesonide 400mcg rotacap, formoterol 6mcg plus budesonide 200mcg rotacap, formoterol 6mcg plus budesonide 400mcg rotacap, ointfourderm cream chlorhexidine gluconate 0.20 percent plusclobetasol topical 0.05 percent miconazole topical 2percent neomycin topical 0.5 percent 30 gm, frusemide20 mg plus spironolactone 50 mg tab, frusemide 40 mgtab, gabapentin 100 mg tab, gabapentin 300 mg plusmethylcobalamin 500 mg tab, gabapentin 300mg plusmethylcobalamin 1500 mcg tab, gamma benzenehexachloride 1 percent plus cetrimide 0.1percent 100mllotion, gatifloxacin 0.3 prcent bott of 5 ml eye drop, gauze absorbent folded, 1 cm x 100 metres, gauzesurgical 60 cm wide, ginkgo biloba 120 mg tab, gliclazide 40 mg tab, gliclazide 60 mg mr tab, gliclazide80 mg tab, glimepiride 2mg plus metformin 500mg tab, glimepiride 2 mg plus metformin 500 mg sustained releasetab, glimipride 2 mg plus metformin sr 500 mg plusvoglibose tab, glucosamine 500 mg plus diacerin 50 mgtab, glucosamine 500 mg plus chondriotin 400 mg tab, glucosamine 750 mg plus diacerine 50 mg plus msm 200mg tab, dextrose monohydrate for oral use, glycerin ipbott of 100ml lotion, glyceryl nitrate 2.6 tab, glycerylnitrate 6.4 nitrocontin tab, guaiphenesin ip 100mg plusdextramethorphan 10mg plus phenylepherine 5mgchlorpheniramine 4mg each 5ml sugar free syp, gum paint15 ml, haloperidol 5mg tab, hdl kit lab, heal pad, ointheparin 15g 20g, hydralazine 37.5 plus isisorbide dinitrate20 mg tab, hydrochlorothiazide 12.5 mg tab, hydroxymethyl cellulose eye gel, hydroxyzine 25 mg tab, ibuprofen plus cholorzoxazone plus pcm tab, imatinib 400mg cap, indomethacin 25 mg cap, indomethacin 75mgcap, inh beclomethason 200mcg 200 meter dose inhaler, inh formoterol 6 mcg plus tiotropium 9mcg mdi duovainhaler, inh indacaterol 110 mcg plus glycopyrrolate 50mcg inhaler, inh tiotropium bromide 9 mcg plusformoterol 6 mg plus ciclesonide 200mcg 200 meter doseinhaler, inj pheniramine 22.75 mg ml injection, injadrenaline 1 isto 1000 1 ml, inj amikacin sulphate 250 mgml injection, inj atropine 0.6 mg 1 ml injection, injdexamethasone 2 ml vial injection, dextrose inj 25 percent25 ml injection, inj dextrose 25 percent injection, injdextrose 50 percent injection, inj diclofenac 25mg ml 3mlinjection, inj dicyclomine 20 mg injection, injerythropoietin recombinant human 2000 iu injection, injetophyllne 84.7 plus theophylline 25.3 ml injection, injfrusemide ip 20 mg ml injection, inj glulisine cart injection100iu ml injection, inj human mixtard 50 50 injection, ferric hydroxide sucrose complex 20 mg in 5ml forinjection, inj methylcobalamin 1000mcg plus vitamin b6pyridoxine 100mg plus nicotinamide 100mg injection, injmethylcobalamin 1500 mcg, inj nandrolone decanoate25mg ml injection, inj normal saline 100 ml injection, injolanzapine 405 mg injection, inj ondansetron 2 mg mlinjection, ipravent solution ipratropium bromide respules, inj pantoprazole 40 mg injection, inj rabipur vaccine 1 mlinjection, inj tramadol injection, inj tranexamic acidinjection, inj tt tetanus toxoid 5 ml injection, inj vitamind3 600000iu arachitol injection, inj zoledronic acid 4 mg    //bid details2 / 109 injection, isabgol ispaghula husk 3.5 gm, isosorbidmononitrate 10 mg tab, isosorbid mononitrate 20 mg tab, isosorbide dinitrate 10 mg tab, isosorbide dinitrate 5 mgtab, isosorbide mononitrate 30mg tab, isotretinoin 10 mgtab, itopride 150 mg tab, itopride 50 mg tab, itraconazole 200mg cap, ivermectin 6 mg tab, ketoconazole 2 percent plus zinc pyrithione 1 percent bottleof 60 ml lotion, ketoralac 0.4 percent eye drop, kit forestimation of alkaline phosphate lab, kit for estimation ofbilirubin, kit for estimation of cholestrol, kit forestimation of glucose lab, kit for estimation oftriglyceride lab, kit for estimation of uric acid lab, kneecap small, knee caps size l, plaster adhesive zinc-oxide7.5cm x 5mtr, polyethylene glycol ip 118gm. sod chloride2.93 gm, pot chloride 1.484 gm sod bicarb 3.37 gm sodsulphate 11.35gm, potassium chloride 150 mg injection, oint povidone plus metronidazole oint, povidone iodinegargle 2 percent w obliq v bott of 100 ml lotion, povidoneiodine sol 10percent bottle of 100 ml lotion, povidoneiodine solution 5 percent bottle of 100 ml lotion, ointpovidone iodine 5 percent w obliq w tube of 15 gm, powder clotrimazole 75 gm, pramipexole 0.25mg tab, pramipexole 0.5 mg tab, pramipexole 1 mg tab, prasugrel10 mg tab, prasugrel 5 mg tab, prazosin sr 2.5 mg tab, prazosin sr 5 mg tab, prednisolone 10mg tab, prednisolone 20 mg tab, prednisolone 5 mg tab, pregabalin 75 mg plus nortriptyline 10 mg plusmethylcobalamin 1500 mcg tab, pregabalin 75 mg plusnortryptiline 10 mg tab, pregabalin 75mg plusmethylcobalamin 750 mg tab, pregabalin sr 75 mg tab, prochlorperazine maleate 5mg tab, promethazine 25 mgtab, propranol 40 mg tab, propranolol 10 mg tab, propranolol 20 mg tab, propranolol t r 40 mg tab, proteinpowder, prucalopride 1 mg tab, prucalopride 2 mg tab, pulv protein supplement formula for renal patient 200 gmcontainer, pyridoxin 40 mg tab, quetiapine 100 mg tab, quetiapine 25 mg tab, quetiapine 50 mg tab, rheumatoidfactor latex test kit r.a factor lab, rabeprazole 20 mgtab, rabeprazole 20 mg plus levosulpride 75mg tab, rabeprazole 20mg plus itopride 150mg tab, rabeprazole20mg plus domeperidon 10mg tab, ramipril 1.25 mg tab, ramipril 10 mg tab, ramipril 2.5mg tab, ramipril 5 mgtab, ranolazine 500 mg tab, ranolazine sr 500 mg tab, tolvaptan 15 mg tab
  • View Tender
  • Document
  • Bid Support
5 Security Services
image image
Central Government/Public Sector
TRN :35619638 |  27 Oct, 2025
Tender Value : 20.86 Lacs
 Gwalior - Madhya Pradesh
Tender for gem bids for lab, occult blood test kit kit of 50 tests zn stain kitreadymade gram stain kit readymade blood agar baseinfusion agar hi media cled agar with thymol blue macconkey agar nutrient agar mac conkey broth hi mediadouble strength bott of 500 gm mac conkey broth himedia single strength bott of 500 gm hi mediabiochemical test kit kb002 20 kit per pack mac conkeybroth 15 x 10 ml kit of 50 abst disc ampicillinsulbactum abst disc amikacin abst disc cefoxitin abst disc clindamycin abst disc gentamycin abstdisc cotrimoxazole abst disc imipenam abst discofloxacin abst disc linezolid abst discteicoplanin abst disc erythromycin abst disctetracycline abst disc vancomycin abst disclevofloxacin abst disc meropenam abst discceftazidime abst disc ceftriaxone abst discciprofloxacin abst disc nitrofurantoin abst discnetilmycin abst disc tobramycin abst discaztreonam abst disc colistin abst discamoxycillin clavulanic acid abst disc cefepime abst disc polymixin b abst disc bacitracin abstdisc optochin abst disc cefuroxime abst discpiperacillin tazobactam abst disc cefadroxil abst disc norfloxacin abst disc trimethoprimsulfamexthoxazole abst disc ticracillinclavulanic acid diamond glass writing liquorformaldehyde 40 percent w oblique v paraffin wax melting56 degree centrigrade to 60 degree centrigrade replacesglass cover microscopic rectangular pv 16442 22 x 50 mmmade of usp no 1 glass pkt of 14 gm replaces glass covermicroscopic rectangular pv 16446 22 x 40 mm made of uspno 1 glass pkt of 14 gm glass cover microscopicrectangular 22x30 mm made of usp no 1 glass slide bid number gem2025b6726583 dated 12-10-2025 bid document1 72 0 0 microscope thickness 1 point 15 to 1 point 35 mm size 75mm x 25 mm, alcohol dehydrated ethanol, xylene xylolpure, tissue cassettes plastics, whatman filter paperdiameter 125 mm cat no 1001 to 125, couplin jar, diluent celquant edge 20 ltr, lyse celquant edge 500 ml, rinse celquant edge 5 ltr, enzyme cleaner celquant edge70 ml, probe cleaner celquant edge 50 ml, print roll size76 mm, g6pd kit of 10 test, prothrombin time reagents togive control of 10 to 14 secs, binocular microscope bulbs, alcohol methyl, bovine albumin 22 percent, anti h lactin, serum anti human globulin, serum haemaglutinating gpab anti ab monoclonal, disposable lancet for finger prickpkt of 100, serum haemaglutinating gp b anti amonoclonal, serum haemaglutinating gp a anti bmonoclonal, elisa reader thermal paper for, distilled water, tissue paper roll, crp rapid kit 35 test each, widal testkit 4 x 5 ml 50 tests per kit, dextrose monohydrate powder100 gm, cotton wool non absorbent pkt of 500 gm, syringe disposable plastic sterile 2 ml with needle, syringedisposable plastic sterile 5 ml with needle, syringedisposable plastic sterile 10 ml with needle, cotton woolabsorbent pkt of 50 gm, cotton wool absorbent pkt of 500gm, gauze absorbent folded 2 point 5 cm x 100 meters, lint absorbent cotton, surgeons mask disposable, steriledisposal hand glove 7 size powder free, chloroxylenesolution dettol, disposable gown and cap and mask set, alcoholic hand disinfectant rub containing 2 propanol ip 45gm 1 propanol ip 30 gm ethyl hexadecyl dimethylammonium ethyl sulphate point 2 gm mecetronium ethylsulphate 100 ml bott, sodium hypochlorite 5 percent, vaccutainer sterile glass 4 ml yellow, phenol carbolic acidbott of 500 ml, amylase, lipase, bio norm, bio path, biocal, sample cup, cholesterol, total protein, triglycerides, hba1c, hdl cholesterol, creatinine kinase nac, po2membrane, calibration pack ultra 1 with creatinine, ultrachem 9 internal qc multipack without creat, ultra abg gasauto qc pack, pco2 membrane, so2 percent calibrationampoules
  • View Tender
  • Document
  • Bid Support
6 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
7 Security Services
image image
Central Government/Public Sector
TRN :35614743 |  01 Nov, 2025
Tender Value : 0
 Imphal - Manipur
Tender for gem bids for cap autrin pizer , cap becosule z aboott , tab b compex zevit , cap doxycycline hydrocloride 100mg , cap evion 400 mg , cap itraconazole 200mg , cap pantop dsr , cap tripsyn and chymotripsyn chymoral forte , tab aceclofenac plus serratiopeptidase plus paracetamol , tab albendazole 400mg , tab amlodipine besylate 5mg , tab amoxycillin 500mg clavulanic acid 125mg gsk , tab antacid chewable abbott , tab aspirin 75mg usv , tab atorvastatin 10mg , tab azithromycine 500mg alembic , tab bisacodyl 10 mg , tab calcium carbonate 500mg plus vit d3 shalcal , tab cefixime 200mg , tab cetrizine dihydrochloride 10mg , tab clopidogrel 75mg , tab combiflam sanofi , tab common cold sinarest , tab cough lozenges , tab cipzox cipla , tab diclofenac sodium 50mg novartis , tab dicyclomine hcl 20mg paracetamol 325mg , tab domperidone 10mg , tab fexofenadine 180mg sanofi , tab fluconazole 150mg , tab folic acid 5mg , tab glimepride 1mg , tab glucosamine 500 mg , tab indapamide , tab levocetrizine 5mg , tab limcee 500 mg , tab losartan 50mg , tab liv 52 , tab metformin sr 500 mg , tab methylcobalamine 1500mcg , tab montelukast 10mg levocetrizine 10mg cipla , tab metronidazole 400 mg , tab naproxen 250mg , tab norfloxacin 400mg , tab ondansetron 4mg , tab pantoprazole 40mg cipla , tab paracetamol 500mg dolo , tab paracetamol 650mg dolo , tab pheniramine maleate avil 25mg , tab pregabalin 75mg , tab pregabalin 75mg plus methylcobalamine 1500mcg , cap preprobiotic , tab rantac 150 mg , tab telmisartan 40mg , tab thyroxine 50 mcg , vaginal pessary clotrimazole 100mg , syp azithromycine 200mg 5ml 60ml , syp albendazole 10ml , syp amoxycillin clavulanic acid bott of 30ml , syp amoxycilline bott of 30ml , syp antacid gel each 5ml containing dried aluminium hyroxide gel 170ml , syp benadryl bott of 160 ml johnson johnson , syp b vitamin b compex multivitamin b 12 bott of 200 ml , syp calcium with vitamin d3 160 ml bott , syp cetrizine 60ml , syp chlorpheniramine maleate pcm phenylephrine 60ml common cold , syp cough expectorant 5ml containing diphenhydramine bott of 100ml , syp iron for adults with vitamins 200ml , syp lactulose bottle of 100ml dufalac , syp ofloxacine 100mg 5ml metronidazole200mg 5ml 30ml , syp ondansetron 2mg 5ml in 30ml , syp combiflam bott of 60 ml , syp paracetamol 250 mg , syp salbutamol 2mg 5ml bottle of 100ml , syp sucralfate bott of 200ml , drop dicyclomine simethicone 10 ml , mouth wash chlorhexidine 100ml colgate , oint diclofenac nanoforte gel tube of 30 gm , oint anti haemorhoidal , oint clindamycin phosphate 1 topical gel tube of 10gm , oint luliconazole 1 30gm , oint miconazole nitrate tube of 15gm , oint mouth ulcer gel , oint mupirocin 2 5gm , oint povidone iodine 5 tube of 10gm , oint silver sulphadiazine 1 tube of 15gms , oint clotrimazole tube of 15 gm , cream urea bott of 20 gm , cream sunscrean lashield , lotion calamine 100ml , lotion dynapar qps bott of 50 ml , gargle povidone iodine bott of 100 ml , spray analgesic voliny spray , liq povidone iodine 5 100ml , e d tear plus cmc refresh tear , e d ciprofloxacin dexamethasone 5ml cipla , e d moxifloxacin 05 5ml cipla , mouth paint clotrimazole bott of 5 ml , ear d waxsole bott of 15 ml , pdr clotrimazole 1 bott of 75mg , sachet calciferol 60000 iu cadila , sachet isabgol ispaghula husk 3 point 5gm , sachet oral rehydration salt ors 20 point 5g , inhalar seroflo 250 mcg , n d sodium chloride 0 point 65 15ml nasoclear , n d xylometazolidine 10ml adult , nd oxymetazoline hcl , disposable mask triple layer , dressing medicated adhesive 25cmx 6cm single strip pack band aid , bandage crepe15cm , hand sanitizer 100 ml bott , sanitary pad , steamer , nebuliser , bp apparatus digital , tennis elbow support size l andxl , tynor portable ortho heating pad , elbow support , ankle support , arm sling pouch , knee cap tynor size m and l , l s belt tynor size m and l , silicon heal pad tynor , walker , walking stick , wheel chair foldable , glucometer strips accucheck active bot of 50 , glucometer accucheck active , cervical collar tynor , powder protein 200gm , pdr glucose d pkt of 30 gm , lotion v wash bott of 100 ml , shampoo scalpe plus ketokonazole , tab sitagliptin 50 mg , tab tamsulosin 0 point 4 mg , syp liv 52 , tab meftal spas , tab zinc sulphate 20 mg , syp zinc 20 mg 5ml cap autrin pizer, cap becosule z, tab b compex zevit, cap doxycycline hydrocloride 100mg, cap evion 400 mg, cap itraconazole 200mg, cap pantop dsr, cap tripsyn and chymotripsyn chymoral forte, tab aceclofenac plus serratiopeptidase plus paracetamol, tab albendazole 400mg, tab amlodipine besylate 5mg, tab amoxycillin 500mg clavulanic acid 125mg gsk, tab antacid chewable abbott, tab aspirin 75mg usv, tab atorvastatin 10mg, tab azithromycine 500mg alembic, tab bisacodyl 10 mg, tab calcium carbonate 500mg plus vit d3 shalcal, tab cefixime 200mg, tab cetrizine dihydrochloride 10mg, tab clopidogrel 75mg, tab combiflam sanofi, tab common cold sinarest, tab cough lozenges, tab cipzox cipla, tab diclofenac sodium 50mg novartis, tab dicyclomine hcl 20mg paracetamol 325mg, tab domperidone 10mg, tab fexofenadine 180mg sanofi, tab fluconazole 150mg, tab folic acid 5mg, tab glimepride 1mg, tab glucosamine 500 mg, tab indapamide, tab levocetrizine 5mg, tab limcee 500 mg, tab losartan 50mg, tab liv 52, tab metformin sr 500 mg, tab methylcobalamine 1500mcg, tab montelukast
  • View Tender
  • Document
  • Bid Support
8 Security Services
image image
Central Government/Public Sector
TRN :35615082 |  21 Oct, 2025
Tender Value : 0
 Kota - Rajasthan
Tender for gem bids for echs, itopride 50 mg tab itraconazole 100mg tab ivabradine 5 mg tab ketoconazole 2 percent cream ketoconazole shampoo 2 percent bottal of 60 ml ketorolac 10 mg tab labetalol 100mg tab lactitol 10gm ispaghula 35gm powder lamotrigine50 mg tab leflunomide arava 10 mg tab levetiracetam sr 500 mg tab levocarnitine 500mgmethycoba 1500 folic acid 15 mg tab levocetrizine5mg montelukast 10mg tab levocetrizine 5mg tab levodopa 100mg carbidopa 10mg tab levodopa100mg carbidopa 25mg tab levodopa 200 mgcarbidopa 50 mg cr tab levoflox 500 mg tab levosalbutamol 100mcg beclometasone 100mcgrotacap levosalbutamol 50mcg beclometasone50mcg inhaler levosulpiride 75mg esomeprazole40mg cap lignocaine jelly with plastic nozzle linagliptin 5 mg tab linezolid 600 mg tab lorazepam 1 mg tab l-ornithine l aspartate tab losartan 25mg tab losartan 50 mg tab losartan50mg hydrochlorthiazide 125mg tab luliconazolecream mebeverine 135 mg tab metformin 500 mgvildagliptin 50 mg tab metformin sr 1000 mg tab metformin sr 500 mg tab methotrexate 15 mg tab methylcobalamin 1500mcg alpha lipoic acid 100mgmyoinositol 100mg folic acid 15mg chromiumpicolinate 200mcg selenium 55mcg benfotiamine150mg cap methylcobalamin 1500 mg tab methylprednisolone 8 mg tab methylprednisoloneacetate 80mg inj metoprolol 25 mg tab metoprolol sr 50 mg tab micronised flavonoid500mg tab mirabegron 25mg tabor cap mirabegron 50 mg tab mirtazapine 15 mg tab montelukast 10 mg tab moxonidine 02mg tab bid number gem2025b6737421 dated 11-10-2025 bid document1 83 0 0 multivitamin and multimineral tab, mupirocin 2percent oint 5 gm, mycophenolate 500 mg tab, mycophenolate sodium 360mg tab, nandrolonedeconate 50 mg inj, naproxen 500 mg tab, neomercazole 10mg tab, neurobion forte tab, nicorandil 5 mg tab, nifedipine retard 20 mg cap ortab, nitrofurantoin 100 mg cap, norfloxacin400mg tinidazole 600mg tab, normal saline 500ml, nortriptyline 25 mg tab, ofloxacin 200mg tab, ointbeclomethasone salicylic acid, oint miconazole 20gm, olanzapine 10 mg tab, olanzapine 5 mg tab, olmesartan 20 mg tab, olmesartan 40 hctz 12.5 mgtab, olmesartan 40 mg tab, olopatadine 0.1percent bottle of 5 ml eye drop, omega fatty acidantioxidant cap, ondansetron 8 mg tab, oralteething sol zytee mouth lotion 10ml mouth ulcergel, ors sachet, oxcarbazepine 150 mg tab, oxcarbazepine 300mg tab, pantaprozole 40 mgdomperidone 10 mg pan d, paracetamol 500 mg tab, paracetamol 500mg ibuprofen 400mg tab, paracetamol 650 mg tab, paradichlorobenzene 2percent benzocaine 2.7 percent chorbutol 5percent turpentine oil 15 percent ear drop, paroxetine 12.5mg tab, permethrin 5 percent tubeof 30 gm, phenytoin sodium 100 mg, piracetam 800mg tab, polyethelen glycol and propylene glycoleye drop, polyethylene glycol purgative powder ip118gm sod chloride 2.93 gm pot chloride 1.484 gmsod bicarb 3.37 gm sod sulphate 11.35gm, povidoneiodine gargle, povidone iodine sol 10 percentbottle of 100 ml, povidone iodineip 5 percent tubeof 15 gm, pramipexole 0.5 mg tab, prasugrel 10 mgtab, prazosin sr 2.5 mg tab, prazosin sr 5 mg tab, prednisolone 10mg tab, prednisolone 5 mg tab, pregabalin 50 mg tab, pregabalin 75 mgnortriptyline 10 mg methylcobalamin 1500 mcg tab, pregabalin 75 mg ntp 10 mg tab, pregabalin 75mgmethylcobalamin 750 mg tab, pregabalin sr 75 mgtab, prepro probiotic tab, prochlorperazinemaleate 5 mg tab, propranol 40 mg tab, propranolol 10 mg tab, protein powder pack of 200gm, pulv protein supplement formula for renalpatient 200 gm, pyridoxin 40 mg tab, quetiapine 50mg tab, rabeprazole 20 mg tabitopride 50 mg tab, itraconazole 100mg tab, ivabradine 5 mg tab, ketoconazole 2% cream, ketoconazole shampoo 2% bottal of 60 ml, ketorolac10 mg tab, labetalol 100mg tab, lactitol 10gm +ispaghula 3.5gm powder, lamotrigine 50 mg tab, leflunomide arava 10 mg tab, levetiracetam sr500 mg tab, levo-carnitine 500mg methycoba 1500folic acid 1.5 mg tab, levocetrizine 5mg +montelukast 10mg tab, levocetrizine 5mg tab, levodopa 100mg + carbidopa 10mg tab, levodopa100mg + carbidopa 25mg tab, levodopa 200 mg +carbidopa 50 mg cr tab, levoflox 500 mg tab, levosalbutamol 100mcg + beclometasone100mcg rotacap, levosalbutamol 50mcg +beclometasone 50mcg inhaler, levosulpiride75mg + esomeprazole 40mg cap, lignocaine jellywith plastic nozzle, linagliptin 5 mg tab, linezolid600 mg tab, lorazepam 1 mg tab, l-ornithine l-aspartate tab, losartan 25mg tab, losartan 50 mgtab, losartan 50mg + hydrochlorthiazide 12.5mgtab, luliconazole cream, mebeverine 135 mg tab
  • View Tender
  • Document
  • Bid Support
9 Security Services
image image
Central Government/Public Sector
TRN :35605908 |  01 Nov, 2025
Tender Value : 90.08 Lacs
 Jabalpur - Madhya Pradesh
Tender for gem bids for general, bid number gem2025b6714303 dated 11-10-2025 bid document1 73 0 0 clotrimazole eardrops, coenzyme q to 10 100 mgtab, coenzyme q 300 mg tab, collagen basedgranules, collagen peptide plus hyaluron, collagen peptide 40 mg plus sod, combipack ofamoxicillin 750, cotrimoxazole ds tab, cremaffinliquid paraffin 1.25, cudcee forte tab, cyclosporin50 mg tab, cyproheptadine 4 mg tab, dabigatran 75mg tab, dabrafenib 50 mg tab, dabrafenib 75 mgtab, daflon 500mg diosmin 450 mg, dapagliflozin 10mg plus metf, dapagliflozin 5 plus linaglip, dapagliflozin 5 mg plus metf, deca peptide lotion, deflazacort 12 mg tab, deflazacort 30 mg tab, dental gel, denture adhesive powder, desidustat50 mg tab, desloratadine 10 mg tab, desloratadine5 mg tab, desvenlafaxine 100 mg tab, desvenlafaxine 25 mg tab, desvenlafaxine 75 mgtab, dettol 100 ml bottle, dettol 500 ml bottle, diclofenac plus paracetamol, diclofenac 100 mgplus metaa, diclofenac 50 mg plus serrat, diclofenac gel of 10 gm vovrn, dicyclomine dropsof 15 ml syp, dienogest 2mg, diltiazem 30 mg tab, diltiazem cd 120 cap per tab, diltiazem gel, diosminplus hesperidin 1000, disodium hydrogen citrate s, distilled water, divalproex 250 mg tab, divalproexsodium cr 500 nos, divalproex sodium sr 1000 nostab, donepezil 5mg plus memantine, dosulepin 25 mgdothiepin tab, drotaverine 80 mg plus aceclo, duloxetine 10 tab, duloxetine 30 mg tab, dynaparqps plus spray, ed 0.2 percent olopatadine hydr, edbimatoprost 0.01 percent, ed boric acid, edbrinzolamide 1.0 plus timoll, ed bromfenac 0.09percent, ed bromofenac, ed candibiotic, eye dropcarboxy methyl cell, ed cyclosporine 0.05 percent, ed fluorometholone acetate, ed hydroxy propylmethylcellu, ed loteprednol 0.5 percent plus, ednetarsudil 0.02 percent, ed olopatadine plusketorolac, ed potassium iodide sodium, edprednisolone 1 percent, ed travaprost plus timolol, empagliflozin 5 mg plus metf, enalapril 10 mg tab, enteral feed powder protein, epalrestat 150mgplus methyl, escitalopram 10 mg plus clo, escitalopram 20 mg tab, escitalopram 5 mg plusclona, esmoprazole 20 mg tab, esomeprazole 20mg plus do, esomeprazole 20 mg tab, esomeprazole40 mg racipr, esomeprazole 40 mg plus cla, etodolac 300mg tab, etodolac 400 mg tab, etofylline 77 mg plus theophy, etophylin 77 mg plustheophylin, etophyllin 150 mg plus theo, etoricoxib60 mg tab, evening primrose 500 mg tab, eveningpromise 1000 cap, eye drops gentamycin plus    //bid details2 / 73
  • View Tender
  • Document
  • Bid Support
10 Security Services
image image
Central Government/Public Sector
TRN :35600769 |  31 Oct, 2025
Tender Value : 0
 Dimapur - Nagaland
Tender for gem bids for sadhbhavna, bid number gem2025b6659728 dated 10-10-2025 bid document1 75 0 0 tab ranitidine 150 mg, tab norflox 400 mg and tinidazole600 mg, tab azithromycin 500 mg, tab diclofenac sodium50 mg, tab neurobion forte, tab norfloxacin 400 mg, tabalbendazole 400 mgg, tab fluconazole 150 mg, tabantacid, tab amlodipine 5 mg, tab promethazinetheoclate 25 mg, syp multivitamin, syp antacid, sypcefixime 50 mg 5 ml bott of 30 ml, oint diclofenac gel 30gm, diclofenac spray, tab calcium 500 mg shelcal, tabfolic acid 5 mg, syp lactulose, ear drop paradichlorobenzene benzocaine 2.7 chlorbutol turpentine oil15 bott of 10 ml waxole, knee cap, ls belt lumbar belt, lotion calamine bott of 100 ml, tab vitamin c, tabmultivitamin, tab ibuprofen and paracetamol, tabdomperidone 10 mg, tab deriphylline, tab clotrimazolevaginal pessaries, tab bisacodyl 10 mg, tab pheniraminemaleate 25 mg, tab anticold, syp iron, syp coughexpectorant 100 ml, syp cetrizine, amoxycillin clavulanicacid syp in 30 ml bott, powder protein, pulv clotrimazole, oint miconazole, oint clobe gm, band aid, asthallininhaler, tab diclofenac potassium and serratiopeptidase, tab haematinic, oint povidone, crepe bandage 10 cm, roller bandage 10 cm, cotton 50 gm, lotion povidoneiodine 10 percent bott of 100 ml, syp tixliyx, nasal dropxylometazoline 10 ml, tab ramipril 5 mg, tab mefanamicacid and dicyclomine, tab ecosprin 75 mg, tabbetahistidine 4 mg, tab tinidazole 500 mg, syppromethazine bott of 60 ml phenargan, syp metronidazoleand oflox bott of 30 ml, syp salbutamol 4 mg, sypbromhexine hcl bott of 100ml, syp triaminic 60 ml, dropmultivitamin bott of 15 ml, drop antispasmodic 15 ml, eyedrop ciprofloxacin and dexamethasone bott of 10 ml, dropnasoclear normal salaine, eye drop flurbiprofen bott of 10ml, ear drop carboxymethylamino amino diphenylsulphone dibucaine and n n dihydroxymethyl carbamide, permethrin 5 percent tube of 30 gm, cream framycetinsulphate bp 1 percent tube of 30 gm, oint clindamycinphosphate 1 percent topical gel tube of 10 gm, gel cholinesalicylate and benzalkonium chloride gel of 10 ml, crepebandage 15 cm, tape micropore 2, ketoconazole lotion 2percent bott of 75 ml, pulv glucose 500 gm, rollerbandage 6 cm, non sterile hand gloves s 7, non sterilehand gloves s 7.5, disposable syringe 2 ml, disposablesyringe 5 ml, inj metronidazole, ns 500 ml, inj heparin, inj ciprofloxacin, inj deriphyllin, inj buscopan, tabacyclovir 400 mg, tab diazepam, tab chloroquine 500 mg, inj pantoprazole, tab metformin sr 500 mg, tabglimipride 2 mg, tab metformin 1 gm, tab indapamide sr, betadine gargle, tab cefuroxime 500 mg, oint acyclovir, inj thiamine, inj vitamin d3, inj ethamsylate, tabciprofloxacin and tinidazole, syp cremaffin, syp liv 52, ear drop clotrimazole and lignocaine
  • View Tender
  • Document
  • Bid Support
  • 1
  • 2
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Related Searched Keywords : protein powder
  • Liquid Paraffin Syrup Tenders ,
  • Stemetil Tenders ,
  • Tramadol Hydrochloride Tab Tenders ,
  • Relcer Gel Tenders ,
  • Calcium Polystyrene Sulphonate Powder Tenders ,
  • Ah Plus Root Canal Sealer Tenders ,
  • Pancreatin Tablet Tenders ,
  • Sugar Free Syrup Tenders ,
  • Antiseptic Germicide Tenders ,
  • Tetracycline Hydrochloride Tab Tenders

Get protein powder Tender Alert...

172297

Related Searched Keywords : protein powder

  • Submersible Borewell Tenders From Maharashtra
  • Table Tenders From Delhi
  • Canal Works Tenders From West-Bengal
  • Subways Tenders From -Tamil-Nadu
  • Bridge Work Tenders From Andhra-Pradesh
  • Building Work Tenders From Gujarat
  • Excavation Tenders From Karnataka
  • Pile Foundation Tenders From Uttar-Pradesh
  • Flood Prevention Work Tenders From Rajasthan
  • Grouting Tenders From Madhya-Pradesh

Read More


Tender Document

399999

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Lift Irrigation Tenders
  • Water Sump Well Tenders
  • Site Preparation Work Tenders
  • Tubewell Tenders
  • Water Proofing Treatment Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.in / ceo@thetenders.in

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App