Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
SubIndustry Tenders
»
Salt
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of salt Tenders

List of latest salt Tenders in Indian Tenders. Click on any salt Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for salt Tenders.

Advance Search
  • All-Tenders (44)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
1 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35631048 |  05 Nov, 2025
Tender Value : 21.34 Lacs
 Nainital - Uttaranchal
Tender for gem bids for anti rainbow trout oncorhynchus mykiss atlantic salmonsalmo salar igm monoclonal antibody lyophilized proteinprepared from bovine free tmb elisa substratesolutionsturbo250 ml per pack bovine serum albuminbsa protease free fatty acid free ph 7 0 50 grams per pack goat anti mouse igg h l secondary antibody hrpconjugated lyophilized polyclonal 2ml per vial hydroxylamine hydrochloride hi ar acs n 1 naphthylethylenediamine dihydrochloride hi ar acs nedd 2phenoxyethanol vanadium iii chloride sodium nitrite sodium nitrate hi lr hydrochloric acid concentrated sodium hypochlorite hi ar acs 4 w v solution ezassaytbars estimation kit for lipid peroxidation 100 reactions ezassaytm reactive oxygen species assay kit frap 200tests agarose low melting field test kit dneasy bloodand tissue kit 50 50 dneasy mini spin columns proteinasek buffers collection tubes 2 ml hematoxylin solution500ml eosin y solution 0 5 alcoholic 500ml histosec 60pastilles without dmso oxolinic acid iodophor chloramine t trihydrate potassium permanganate bhuvision soil nutrient analysis code hg bsna 100 test clearserological pipette 10ml amber glass vials ermamicrotome blades 1 2 propanediol 2 5l erlenmeyerconical flask multi port hplc cap micropipette weigert s iron hematoxylin kit 2x500ml eosin y 5g alcianblue 8gx 10g d p x 100ml paraplast plus 1kg 30acrylamide bis solution 29 1 l thick blot filter paper precut prestained protein ladder methanol glycerol biotin dsorbitol g418 disulfate salt potassium phosphate dibasic potassium phosphate monobasic ptriex 4 neo dnanovagen amicon ultra centrifugal filter 10 kda mwco ampicillin sodium salt imidazole dmso protease andphosphatase inhibitor cocktail tmb enhanced one bid number gem2025b6792045 dated 15-10-2025 bid document1 93 0 0 component hrp membrane substrate, 3 3diaminobenzidine, ammonium persulfate, cobalt iichloride, yepd broth granulated 500g, ypd yepd growthagar 500g, ypd yepd growth medium, yeast nitrogenbase ynb w ammonium sulphate 100g, peptone 500g, yeast extract powder, l histidine, dextrose anhydrous hiar acs, l glutamic acid, l methionine, l lysine hi lr, lleucine, l isoleucine, 10x tris glycine sds gel runningbuffer, 2 5x tris sds buffer ph 8 8, 5x tris sds buffer ph 68, 10x transfer buffer, 5x laemmli buffer, 50x tae, rnaisolation, sedgewick rafter counting chamber cell, borosilicate bod bottles, borosilicate dissolved oxygenbottles, uniflo 13mm 0 2 pes s 100 pk, uniflo 13mm 045 pes s 100 pk, uniflo 25mm 0 45 pes s 45 pk, uniflo25mm 0 2 pes s 45 pk, single tubes pcr 0 2 ml transparentwith attached flat cap, microcentrifuge tubes pp 0 5 ml withattached cap with lid closure, microcentrifuge tubes pp 1 5ml with attached cap with lid closure, microcentrifuge tubespp 2 0 ml with attached cap with lid closure, microcentrifuge tubes pp 5 ml transparent, mueller hintonagar granulated 500g, mueller hinton broth 500g, glucose yeast extract agar 500g, glucose yeast extractacetate broth 500g, agar granulated bacteriological grade500g, nutrient agar granulated, nutrient broth granulated, d glucose anhydrous, sodium chloride, xylene forhistopathology 2 5l, resazurin sodium salt 5g, z 2 cl osu100g, mtt 1g, n phenyl 1 naphthylamine 500g, propidium iodide, wizard genomic dna purification kit 100isolations x 300ul, wizard sv gel and pcr cleanup system50 prep, hepes molecular biology grade free acid 100g, disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg, petridish, centrifuge tube conical bottom with lid, selfstanding centrifuge tube with lid, cryovial with externalthreaded self standing sterile, cryo box pp, rack for microtube l, rack for micro tube, universal tube rack pp, universal tube rack, 20c mini cooler with gel filled cover, 0c mini cooler with nontoxic gel, agar powderbacteriological grade, mueller hinton agar, mueller hintonbroth, tryptone soya broth soyabean casein digestmedium, tryptone soya agar casein soyabean digest agarsoyabean casein digest agar, steriswift disinfectant wipes, polyethylene glycol mw 6000, sterile cotton swab, 2 10ulaerosol barrier gentip, 20 200ul aerosol barrier gentip, 100 1000ul aerosol barrier gentip, wrappup alluminiumfoils, biosoft tissue, kimwipes, kimberly clark, ecosafedisinfectant, centrifuge tube, petri dish, syringe
  • View Tender
  • Document
  • Bid Support
2 Sports And Health Services
image image
Central Government/Public Sector
TRN :35618194 |  04 Nov, 2025
Tender Value : 0
 Bangalore - Karnataka
Tender for gem bids for atta, rice fine quality, rice floor, maida, corn floor, sugar, jaggery, avalakki, puliyogare powder, sooji, toordal, moong dal, black channa, channa dal, moong whole, fried gram, urad dal, kabuli channa, green peas, horsegram, alasande kalu, white rajma, red chilly byadigi, chilly power kashmiri, dhaniya coriander seeds, dhaniyacoriander powder, turmeric powder, methi, mustard, cumin seed jeera, jeera powder, black pepper, blackpepper powder, coconut powder desicates, cloves, cinnamon stick, cardamom, ananas flower, marathimoggu, kasturi methi, biryani leaves, asafoetida, somp, soya bean sauce, japathre, table salt, salt, tamarindseedless, mixed fruit jam, broken wheatyellow, oats, mussali, chocos, cornflakes muesli, vermicelliall verities, custard powder, jamoon mix, dry grapes, cashew nutbroken, cashew nut whole, tea powder, tea bags, coffee, channa masala, chat masala, garam masala, chicken masala, mutton masala, biryani masala, kababmasala, sambar powder, rasam powder, teriyaki sauce, tomato sauce-, vinegar, chilly sauce, lemon salt, noodles, groundnut seeds, bengal gram flour, ragi floor, sunflower oil, ghee, pickle mixed, papad, biscuits sweetsalt khara, food color, sabbakki
  • View Tender
  • Document
  • Bid Support
3 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35618401 |  04 Nov, 2025
Tender Value : 16.02 Lacs
 Nainital - Uttaranchal
Tender for gem bids for iron chloride reagent grade sulfanilamide 98 sodiumsalicyclate wrapup alluminium foils 18 micron 70 meter 4pack kimwipes 60 box cs cryo tags for 1 5ml tubes 1000roll 1 5 ml boil proof microtubes clear non pyrogenic rnasednase free 500 tubes unit 10 unit sper case 200 uluniversal tip non sterile low retention bulk 1000 pk 10000cs sodium azide sq 4 amino anti pyrine sq phenol sq benzoic acid sq glacial acetic acid acs grade 1050 kgm3 dimethyl sulfoxide dmso acs 3 n morpholinopropanesulfonic acid mops glass centrifuge tube stainless steel test tube rack quantitative filter paper total protein test kit albumin test kit bromocresol greenend point assay kit triglycerides gpo pap end point assaykit ast aspartate transaminase modified uv ifcc kineticassay kit alt alanine transaminase modified uv ifcckinetic assay kit glucose assay kit god pod alkalinephosphatase pnpp assay kit n succinyl ala ala pro phe pnitroanilde na benzoyl l arginine 4 nitroanilidehydrochloride l leucine p nitroanilide sodium cholatehydrate 4 nitrophenyl palmitate biuret reagent epinephrine screw cap sample bottle polypropylene 500ml micro centrifuge tubes 0 6ml micro centrifuge tubes 15ml micro centrifuge tubes 2ml pcr tube rack withhinged lid 96 places 0 2ml pcr tube strips with flat caps 01ml 8 tubes strips pcr tube with flat caps 200ul universaltips non sterile low retention bulk 10ul universal tips nonsterile low retention bulk 1ml universal tips non sterilelow retention bulk parafilm 4 inches 125 meters 5 mlsyringes with needle needles for syringe 23 gauge alamar blue resazurin sodium salt cell culture testedc12h6nnao4 mw 251 17 leibovitz s l 15 medium w lglutamine w o sodium bicarbonate antibiotic antimycoticsolution 100x liquid endotoxic tested sodium pyruvate bid number gem2025b6789146 dated 14-10-2025 bid document1 122 1 1 solution 100mm, mem non essential amino acids solution100x, 1n hydrochloric acid solution sterile filtered 10 x 20ml, parafilm m sealing film 100mm 38mtr dimension mm132x135x112, syringe driver filters cellulose acetatehydrophilic membrane pore size 0 22um 25mm diamterewith prefilter sterile, syringe driver filters cellulose acetatehydrophilic membrane pore size 0 45um 25mm diamterewith prefilter sterile, sterifast in 500ml dispenser bottle wpump, hishield hand wash in 1 lit can pack, germitol 5 litcan pack, steriswift disinfectant wipes size 6x8, glycerol 12 3 propanetriol for molecular biology, calcium chlorideanhydrous cell culture tested, luria bertani agar miller, tryptone soya agar casein soyabean digest agar, tryptone soya broth soyabean casein digest medium, magnesium chloride anhydrous grade 100g molecularbiology grade, polyethylene glycol average mol wt 3 350250g, colchicine 1g, nuclease free water 10x50ml depctreated for molecular biology, glutaraldehyde solution 25 inh2o, whatman quantitative filter papers ashless grade 5891 black ribbon circles diam 185mm pack of 100, acetic acidglacial 100 anhydrous for analysis emsure, filter tip inrack 200ul 96 tips x 10 racks x 10 packs box, filter tip inrack 1000ul 96 tips x 6 racks x 10 packs box, serologicalpipette crystal grade polystyrene ps sterile individuallypacked 5ml pieces sleeve 1 pieces inbox 100 pieces case400, serological pipette crystal grade polystyrene pssterile individually packed 10ml pieces sleeve 1 piecesinbox 100 pieces case 400, serological pipette crystalgrade polystyrene ps sterile individually packed 25mlpieces sleeve 1 pieces inbox 100 pieces case 400, cryovialexternally threaded clear total volume 1 2ml packed in 50500 sterile, alkalinity total for 50 tests, calcium hardnessfor 50 tests, hardness for 50 tests, magnesium for 50tests, nitrate for 50 tests, nitrate n for 50 tests, nitratenano2 for 50 tests, ph phenol red for 50 tests, phosphate lr for 50 tests, potassium for 50 tests, sulfatefor 50 tests, staphylococcus aureus atcc 25923, staphylococcus aureus subsp atcc 29213, staphylococcusaureus subsp atcc 43300, k pneumoniae atcc 700603, kpneumoniae atcc baa 1705, e coli atcc 25922, coagulase plasma from rabbit, tryptone broth w 10 nacl, baird parker agar medium, alkaline peptone water, ecbroth, ampicillin dextrin agar base, potato dextrose agar, potato dextrose broth, levine eosin methylene blue agarmedium, glucose peptone agar, chloramine t hydrate, oxytetracycline dihydrate, d galactose, d mannitol, dmannose, d xylose, inositol, dulcitol, l rhamnosemonohydrate, d sorbitol, d raffinose pentahydrate, dtrehalose dihydrate, adonitol, d salicin, d melibiosemonohydrate, esculin fermentation broth, gelatin hi lr, sodium hydroxide, simon citrate agar, sm agar, simmedium, starch agar, indole nitrate medium, urea agarbase, glucose of medium, phenol red broth base, mr vpmedium buffered glucose broth, dnase test agar w methylgreen, triple sugar iron agar, ornithine decarboxylasebroth, lysine decarboxylase broth, arginine dihydrolasebroth, glycerol hi ar, tryptone soya broth soyabeancasein digest medium, esculin agar, muller hinton agar, gram stains kit, durham tubes, o gene ruler 1kb dnaladder, o gene ruler 100bp dna ladder plus, taq dnapolymerase recombinant 5 u ul, dntp mix 10mm each, water nuclease free molecular biology grade, 6x loadingdye solution, lysozyme, storage vial self standing pp withhdpe closure, cryo babies, laser cryo babies, tough tags    //bid details2 / 122, spinwin tube conical bottom pp with hdpe closure 15 ml, slid box ps, autoclavable bags pp, sample bags ldpe, beaker pmp, beaker pp, sodium hippurate, acetone, 1butanol, ninhydrin, tagatose, dnase test agar, nutrientgelatin agar, triple sugar iron agar, phenol red dextrosebroth, phenol red sucrose broth, phenol red lactose broth, phenol red maltose broth, phenol red mannitol broth, phenol red dulcitol broth, phenol red salicin broth, phenolred sorbitol broth, phenol red raffinose, phenol redarabinose broth, phenol red xylose broth, phenol redstarch broth, phenol red inositol broth, phenol redgalactose, phenol red rhamnose, phenol red adonitol, phenol red trehalose, cc mount tissue mounting medium, weigerts iron hematoxylin kit, silver stain kit, ermamicrotome blades
  • View Tender
  • Document
  • Bid Support
4 Security Services
image image
Central Government/Public Sector
TRN :35622727 |  23 Oct, 2025
Tender Value : 0
 Aurangabad (Mh) - Maharashtra
Tender for gem bids for e haldi powder, e mirch powder, dhaniya powder, makhana 250gm, corn flour, kala namak, sabut lalmirch, choti elachi, masala elachi, jeera, rai, lemon salt tatri, soof 500gm, dalchini cigrate 500gm, vinegar 650ml, hing 50 gm, kasturi maithi, sabudana, e garam masala 200 gm, e samber masala200 gm, e kitchen king masala 200 gm, e chaatmasala 200 gm, e sabji masala 200 gm, e biryanimasala 200 gm, e chole masala 200 gm, kewda jal, seviyan 200gm
  • View Tender
  • Document
  • Bid Support
5 Security Services
image image
Central Government/Public Sector
TRN :35624117 |  23 Oct, 2025
Tender Value : 0
 Aurangabad (Mh) - Maharashtra
Tender for gem bids for shegdana, kali mirch, loong, ajwain, colours100gm, e haldi powder, e mirch powder, dhaniyapowder, kala namak, sabut lal mirch, choti elachi, masala elachi, jeera, rai, lemon salt tatri, soof, dalchini cigrate, vinegar 650ml, sabudana, egaram masala 200 gm, e samber masala 200 gm, ekitchen king masala 200 gm, e chaat masala 200 gm, e sabji masala 200 gm, e biryani masala 200 gm, echole masala 200 gm
  • View Tender
  • Document
  • Bid Support
6 Security Services
image image
Central Government/Public Sector
TRN :35626132 |  23 Oct, 2025
Tender Value : 0
 Aurangabad - Bihar
Tender for gem bids for condiment, colours 100gm, e haldi powder, e mirch powder, dhaniya powder, makhana 250gm, corn flour, kalanamak, sabut lal mirch, choti elachi, masalaelachi, jeera, rai, lemon salt tatri, soof, dalchinicigrate, vinegar 650ml, hing 50 gm, kasturi maithi, sabudana, e garam masala 200 gm, e samber masala200 gm, e kitchen king masala 200 gm, e chaatmasala 200 gm, e sabji masala 200 gm, e biryanimasala 200 gm, e chole masala 200 gm, kewda jal, seviyan 200gm
  • View Tender
  • Document
  • Bid Support
7 Security Services
image image
Central Government/Public Sector
TRN :35609981 |  03 Nov, 2025
Tender Value : 0
 Jaisalmer - Rajasthan
Tender for gem bids for common salt for chemical industries (v2) conforming to is 797 (q3)
  • View Tender
  • Document
  • Bid Support
8 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
9 Security Services
image image
Central Government/Public Sector
TRN :35612362 |  22 Oct, 2025
Tender Value : 0
 Aurangabad (Mh) - Maharashtra
Tender for gem bids for e haldi powder, e mirch powder, dhaniya powder, sabut lal mirch, choti elachi, masala elachi, jeera, rai, lemon salt, soof, dalchini cigrate, vinegar650ml, e garam masala 200 gm, e samber masala 200gm, e kitchen king masala 200 gm, e chaat masala200 gm, e sabji masala 200 gm, e biryani masala 200gm, e chole masala 200 gm, kewda jal, seviyan200gm, hing 50 gm, kasturi maithi, sabudana
  • View Tender
  • Document
  • Bid Support
10 Railway Transport
image image
Central Government And Public Sector
TRN :35613454 |  06 Nov, 2025
Tender Value : 0
 Bela - Bihar
Tender for supply of edible common salt to is:253/1985.
  • View Tender
  • Document
  • Bid Support
  • 1
  • 2
  • 3
  • 4
  • 5
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Related Sub Industries : Food Grains
  • Food Grain Tenders ,
  • Salt Tenders ,
  • Pulse And Spices Tenders ,
  • Bakery Product Tenders

Get Salt Tender Alert...

920494

Related Sub Industries : Food Grains

  • Locomotive Tenders
  • Valve Tenders
  • Accommodation Tenders
  • Meter Tenders
  • Rubber Product Tenders
  • Building Tenders
  • Chimney Tenders
  • Shearing Machine Tenders
  • Copper Scrap Tenders
  • Lubricant Product Tenders

Read More


Tender Document

292914

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Grouting Work Tenders
  • Compound Wall Tenders
  • False Ceiling Repair Tenders
  • Brickwork Tenders
  • Gate Lodge Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.in / ceo@thetenders.in

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App