Filters

List of cds Tenders

List of latest cds Tenders in Indian Tenders. Click on any cds Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for cds Tenders.

All-Tenders (5)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government / Public Sector

TRN :35608001 | 20 Oct, 2025

Tender Value : 0

Thane - Maharashtra

Tender for gem bids for safety device assembly ts-20-15 drg. no. 2a20. cd21-15.

Central Government/Public Sector

TRN :35608021 | 21 Oct, 2025

Tender Value : 49.0 Thousand

Amritsar - Punjab

Tender for gem bids for cello tape brown tape transparent tap cd dvd marker binder clip small size black clip (big size) tag blue paper pin fevi stick dumper ball pen (red/ black) odonil colour flags cutter and paper weight tea coaster brosil glass pin cushion handwash duster cloth (yellow) duster cloth (white) broom a3 paper a4 size bond paper register 200 page register 400 pg register 100 pg

Central Government/Public Sector

TRN :35608354 | 23 Oct, 2025

Tender Value : 27.58 Lacs

Kangra - Himachal Pradesh

Tender for gem bids for medicine, 5 amino salicylic acid 400 mg mesalamine acebrophylline 200 mg sr aceclofenac 100 andparacetamol 325 and chloroxazone 250 tab hifenac mr aceclofenac 100 mg andthiocolchicoside 4 mg tab aceclofenac sr 200mgtab acenocoumarol acitrom 4 mg tab alfuzosin10 mg and dutasteride 05 mg tab amisulpride 100mg tab amitriptyline 10 mg tab amlodepine 10 mgtab apremilast 30 mg tab aspirin 150 mg andclopidogrel 75 mg aspirin 75 mg and atorvastatin10 mg tab atorvastatin 40 mg tab azelnidipine 8mg tab barrier cream 4720 bisacodyl dulcolax 5 mg tab bisoprolol 5mg tab bromhexine 2mg and guaifenesin 50mg and menthol 1mg andterbutaline 125mg syrup bupropion 150 mg tab calcium acetate 667 mg tab calcium dobesilate tab oxerute catheter foleys silicon 2 way size 22 fg cefixime 200mg and clavulanate 125 mg tab cefpodoxime 200mg and clavulanate 125 mg cap cefpodoxime proxetil 50 mg syp oral suspension chlordiazepoxide 10 mg librium tab chlordiazepoxide 5 mg and clidinium bromide 25 mg librax 5 and 25 chlorthalidone 625 mg tab cilnidipine 10 mg and telma 40 mg tab cilnidipine 10mg tab cilnidipine 5 mg tab cilostazol 100 mg tab cilostazol 50mg tab cinnarizine 75 mg tab clobazam 10mg tab clonazepam 025 mg tab clonazepam 05 mg tab clopidogrel 75 mg andaspirin 75 mg tab clotrimazole 100mg vaginaltablets coenzyme q-10 100 mg tab coloplastpaste 2650 coloplast starp braua elastic tape colostomy bag 60 mm combipack of amoxicillin750mg and tinidazole 500 mg and omeprazole 20 mg bid number gem2025b6757183 dated 13-10-2025 bid document1 145 1 1 hp kit, , corn cap, cough lozenges, daflon 500mg, diosmin 450mg and hesperidin 50mg, tab, dapagliflozin 10 mg and metformin 500 mg tab, dapaglifozin 5 mg tab, deflazacort 6 mg tab, dengue serology rapid kit, desloratadine 10 mgtab, dexamethasone 4mg tab, diazepam 5mg tab, digital x- ray film 10 x 8 agpha, diltiazem cd 120 cap, tab, disodium hydrogen citrate syrup, donepezil5mg and memantine 10mg tab, dosulepin 25 mg, dothiepin, tab, dressing medicated gauze paraffin, 10 cm x10 cm, tin of 24, drotaverine hcl 40 mg tab, ed fluorometholone acetate, etizolam 0.5mg tab, etoricoxib 60 mg tab, filgrastim 300 mcg inj, flupentixole 3 mg tab, gamma tocotrienol deltatocotrienol 400 mg cap, gatiflox and prednisolone10ml eye drops, gatifloxacin 0.3percent eye dropbott of 5 ml, e, d, , glibenclamide 5 mg tab, gliclazide 40 mg tab, glimepride 1 mg and metformin500 mg tab, glimepride 2 mg and metformin 1000 mgsr tab, glipizide 5 mg tab, glucosamine 500 mg anddiacerin 50 mg tab, glucosamine 750 mg anddiacerine 50 mg and msm 200 mg tab, glutathione250 mg tab, glutathione 500 mg tab, glycerylnitrate 2.6 tab, glyceryl nitrate 6.4, nitrocontin, tab, hyaluronic acid 20 mg, hyalgan inj, hydralazine 37.5 and isisorbide dinitrate 20 mg tab, isolazine, , hydroxyurea 500 mg cap, hydroxyzine10 mg tab, ibuprofen 400 mg tab, iguratimod 25 mgtab, imeglimin 500mg tab, indomethacin 25 mg cap, inj biovic 90mg, sodium hyaluronate, , injdenosumab solution 60 mg, ml, prollia, , injerythropoietin recombinant human 5000 iu, injhuman mixtard 30-70, inj iron sucrose, injmethylcobalamin, 1000mcg, and vitamin b6, pyridoxine, , 100mg, and nicotinamide, 100mg, , neurobion, , inj methylcobalamin 1500 mcg, injnandrolone decanoate 25mg, ml, isotonic nasalspary, ivermectin 12mg tab, lenvatinib 4mg tab, levodopa, 100mg, and carbidopa, 25mg, tab, levodopa 100mg and carbidopa 25mg and entacapone200mg, syncapone tab, levosulpiride, 75mg, andesomeprazole, 40mg, cap, lithium carbonate 300mg cap, tab, losartan 50mg andhydrochlorthiazide 12.5mg tab, macvestin 500mgtab, univestin, , mesalamine 1 gm sachet, metolazone 5mg tab, metoprolol xl 12.5 mg tab, midodrine 2.5 mg tab, nebivolol 2.5 mg tab, neomercazole, carbimazole, 10mg tab, nepafenac, 0.3percent w, v, 5 ml ed, nifedipine retard 20 mgcap, tab, nifedipine xl 30 mg tab, olopatadine0.1percent bottle of 5 ml e, d, omega 3 fatty acidcap, omega fatty acid and antioxidant cap, oralteething sol, zytee mouth lotion, 10ml, ostomyadhesive remover spray, pantoprazole 40 andclarithromycin 500 and amoxycilin 750, paradichlorobenzene 2percent w, v and benzocaine2.7percent w, v and chorbutol 5percent andturpentine oil 15percent w, v ear drop, clear wax, , penicillamine 250mg tab, pentoxifylline, 400mg, tab, trental, , pioglitazone 15 mg tab, pioglitazone 30mg tab, piroxicam 20mg tab, polyethelen glycol and propylene glycol, systane, e, d, pramipexole 0.125 mg tab, pregabalin 75 mgand nortriptyline 10 mg and methylcobalamin 1500 //bid details2 / 145 mcg tab, pregabalin 75 mg and ntp 10 mg tab, rabeprazole 20 mg and levosulpride 75mg tab, rabeprazole 20mg and domeperidon 10mg tab, rasagiline 0.5 mg tab, rasagiline 1 mg tab, repaglinide 1mg tab, repaglinide 2 mg tab, rosuvastatin 40 mg tab, s adenosyl l-methionine200 mg tab, s adenosyl -l-methionine 400 mg tab, adesam, , sacubitril 97mg and valsartan 103mg tab, selegiline 5 mg tab, sildenafil 20 mg tab, sildenafil25 mg tab, silodosin 8 mg and dutasteroide 0.5 mgtab, sodium cromoglycate 4percent eye drop, cromal forte, , sotalol 40 mg tab, sterile gauze 4x 4 pkt of 5, syp alpha - amylase pepsin, digestiveenzyme, , syp paracetamol 162 mg and ibuprofen 100mg 60 ml, tacrolimus 0.25 mg tab, tacrolimus0.3percent oint, tacrolimus 2 mg tab, telmisartan 40and amlodipine 5 mg tab, telmisartan 40 mg tab, telmisartan 40 mg and amlodipine 10 mg tab, telmisartan 80 mg tab, tenofovir 300 andlamivudine 300mg and dolutegravir 50mg, tenofovir 300 mg and lamivudine 300 mg andefavirenz 600 mg tab, tenofovir alafenamide 25 mgtab, tetrabenzeme 25mg tab, thiocolchicoside 8mg, myoril, tab, thyroxin 12.5mcg, thyroxine 75mcg tab, ticagrelor 60 mg tab, brilinta, , timololmaleate eye drop 0.5percent bott of 5 ml, tofacitinib11 mg tab, tolterodine 2 mg tab, torsemide 10 andspironolactone 50 mg tab, torsemide 20 mg tab, torsemide 5 mg and spironolactone 25 mg tab, torsemide 5 mg tab, triamcinalone 40mg, kenakort, inj, urostomy bag -60mm, verapamil 40mg tab, vericiguat 10 mg tab, vericiguat 2.5 mg tab, warfarin 1mg tab, warfarin 2mg tab, warfarin 5mg tab, zolpidem 10 mg tab, novopen needle, allsize, , enzalutamide 160 mg, tegafur 20 mg andgimeracil 5.8 mg and oteracil 15.8 mg, simyl mct oil of500 ml, almond oil of 300 ml, raughan -e-shireen, , uncooked corn starch 400 gm, weikfield, , disposabletube westergreen esr, heamolynac 3n, 680g, 500 ml, cleanac, mek 520, pack of 5 ltr, cleanac, mek 620, pack of 5 ltr, micro tips 1-200 ul pkt of 1000, needle24g, tourniquet, vitamin b12, finecare, rapidquantitive test, 25x8, finecare t3, 25test packing, , finecare t4, 25 test packing, , finecare tsh, 25 testpacking, , finecare hba1c, 25tesst packing, , finecare vitd, 25 test packing, 5 amino salicylic acid 400 mg mesalamine, acebrophylline 200 mg sr, aceclofenac 100 + pcm325 + chloroxazone 250 tab hif, aceclofenac 100mg + thiocolchicoside 4 mg tab, aceclofenac sr200mg tab, acenocoumarol acitrom 4 mg tab, alfuzosin 10 mg + dutasteride 0.5 mg tab, amisulpride 100 mg tab, amitriptyline 10 mg tab, amlodepine 10 mg tab, apremilast 30 mg tab, aspirin150 mg+ clopidogrel 75 mg, aspirin 75 mg +atorvastatin 10 mg tab, atorvastatin 40 mg tab, azelnidipine 8 mg tab, barrier cream 4720, bisacodyldulcolax 5 mg tab, bisoprolol 5mg tab, bromhexine 2mg + guaifenesin 50mg 1.25mgsyrup, bupropion 150 mg tab, calcium acetate 667 mgtab, calcium dobesilate tab oxerute, catheterfoleys silicon 2 way size 22 fg, cefixime 200mg +clavulanate 125 mg tab, cefpodoxime 200mg +clavulanate 125 mg cap, cefpodoxime proxetil 50 mgsyp oral suspension, chlordiazepoxide 10 mg //bid details3 / 145

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Corporations/Associations/Others

TRN :35610714 | 20 Oct, 2025

Tender Value : 18.31 Lacs

Nagpur - Maharashtra

Tender for construction of paving blocks, and pipe drain under the scheme of lokshahir annabhau sathe nagari vasti sudhar yojana 2025-26 at n.p. godhani, distt. nagpur. npgr/cd/1894/2025/3

corporations/Associations/Others

TRN :35611879 | 27 Oct, 2025

Tender Value : 1.05 Crore

Sangli - Maharashtra

Tender for shalgaon -bombalewadi industrial area. construction of control room, ucr masonry compound wall with chain link fencing and ms gate and construction of wbm road with cd work and initial asphaltic treatment for 33 kv/11kv substation balance work shalgaon - bombalewadi industrial area. construction of control room, ucr masonry compound wall with chain link fencing and ms gate and construction of wbm road with cd work and initial asphaltic treatment for33 kv/11kv substation. balance work

State Government

TRN :35612193 | 21 Oct, 2025

Tender Value : 35.79 Lacs

Kolhapur - Maharashtra

Tender for construction of cd work on jadhav mala road from gat no. 1159/a/b/c shri. mange to gat no.1159 at hatkanangale

Corporations/Associations/Others

TRN :35612414 | 20 Oct, 2025

Tender Value : 26.73 Lacs

Nagpur - Maharashtra

Tender for construction of c.c. road in nagar panchayat area under scheme of nagari dalitettar nagar panchayat godhanirailway 2work npgr/cd/1894/2025/1

Corporations/Associations/Others

TRN :35612449 | 20 Oct, 2025

Tender Value : 1.00 Crore

Nagpur - Maharashtra

Tender for construction of roads, paving blocks, and pipe drain under the scheme of lokshahir annabhau sathe nagari vasti sudhar yojana 2025-26 at n.p. godhani, distt. nagpur.11 work npgr/cd/1894/2025/4

Central Government / Public Sector

TRN :35613132 | 03 Nov, 2025

Tender Value : 0

Medak - Telangana

Tender for gem bids for stowage & attachment of spta set to drg. no: 675-94-cd3, qai no. cqaicv qai/027

Related Sub Industries : Computer Hardwares And Consumables

List of cds Tenders

Tender for gem bids for safety device assembly ts-20-15 drg. no. 2a20. cd21-15.

Tender for construction of paving blocks, and pipe drain under the scheme of lokshahir annabhau sathe nagari vasti sudhar yojana 2025-26 at n.p. godhani, distt. nagpur. npgr/cd/1894/2025/3

Tender for construction of cd work on jadhav mala road from gat no. 1159/a/b/c shri. mange to gat no.1159 at hatkanangale

Tender for construction of c.c. road in nagar panchayat area under scheme of nagari dalitettar nagar panchayat godhanirailway 2work npgr/cd/1894/2025/1

Tender for construction of roads, paving blocks, and pipe drain under the scheme of lokshahir annabhau sathe nagari vasti sudhar yojana 2025-26 at n.p. godhani, distt. nagpur.11 work npgr/cd/1894/2025/4

Tender for gem bids for stowage & attachment of spta set to drg. no: 675-94-cd3, qai no. cqaicv qai/027

Get Cds Tender Alert...

Related Sub Industries : Computer Hardwares And Consumables

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us