Filters

List of polymer-kit Tenders

List of latest polymer-kit Tenders in Indian Tenders. Click on any polymer-kit Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for polymer-kit Tenders.

All-Tenders (15)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35693606 | 10 Nov, 2025

Tender Value : 0

Haridwar - Uttaranchal

Tender for gem bids for arduino uno r4 wifi , arduino nano 33 iot , raspberrypifive16gb , raspberry pi 27w usb c power supply , raspberry pi monitor , raspberry pi ai camera , mcp3008 chip , raspberry pi pico wh , male to male jumper wires 40pcs 20cm , male to female jumper wires 40pcs 20cm , female to female jumper wires 40pcs 20cm , esp32 38 pin wifi bluetooth nodemcu 32 development board , ads1115 chip , tf luna micro lidar distance sensor for iot its 8m , 300rpm 12v low noise dc motor with metal gears grade a , robot wheel 10cm dia. x 4.4cm width , towerpro mg946r digital high torque metal gear servo motor , l298n based motor driver module 2a , orange icr18650-22f 3.7v 2200mah 2c li-ion battery , 2 x 18650 black battery holder with dc power plug , 3 x 18650 black battery holder with dc power plug , 18650 battery charger 4 bay fast charge, , readytosky mt2204 2300kv cw brushless motor , readytosky 30a 2-6s esc , flysky fs-i6 2.4ghz 6 channel rc transmitter , radiolink pixhawk flight controller board , 3dr single ttl mini radio telemetry 433mhz 500mw for pixhawk and apm fc , quadcopter f450 frame with landing gear , i2c lcd interface module , pro-range 11.1v 4200mah 35c 3s lithium polymer battery pack , nvidia jetson orin nano super developer kit 8gb , 7inch capacitive touch hdmi screen ips lcd with case

Central Government/Public Sector

TRN :35680410 | 05 Nov, 2025

Tender Value : 0

Panchkula - Haryana

Tender for gem bids for ureteric catheter 70 cm open end size 5 fr, toomey syringe70cc, multi ligaclip applicator for open surgery containing25 to 30 medium clips, double j stent with guide wirepusher 26cm 6 fr, foley balloon three way 22 fr, foleyballoon three way 24 fr, two piece urostomy system60 to70 mm kit each containing 10 flanges 10 urostomy pouches2 paste 1 powder 1 belt, foley balloon three way 16 fr, guide wire nitinol core straight tip 0point035 x 150cm, guide wire nitinol core straight tip 0point038 x150 cm, guide wire nitinol core angled tip 0point035x 150 cm, turp drape with attached leggings and watercollecting funnelpoint the drape must have a cord to tiearound the surgeon to facilitate water collection disposable, radiopaque tfe cathe, hemolock size extra large grey 6pcs obq cartridge 14 cartridge obq box, hemolock sizeextra large grey clip applicator, hemolock size mediumgreen laparoscopic clip applicator, two piece urostomysystem 50 to 60 mm kiteach containing 10 flanges 10urostomy pouches 2 paste 1 powder 1 belt, sodium chloridesolution 0point9 percent non toxic plastic bottle of 3000ml, foreign body removal forceps tripod type, hydrophiliccoated guide wire with nitinol core 0point025 150 cmstraight tip, hydrophilic coated guide wire with nitinol core0point032 150 cm angled tip, onco bcg vaccine forintravesical use 40 mg inj, ureteric catheter 70 cm openend size 6 fr, flexible cystoscope disposable, roadrunnerguide wire 0point035 145 cm length double flexible tip 5 cmmarkings with nitinol core platinum tip and aq coating ofmicrothin layer of hydrophilic polymer, roadrunner guidewire 0point038 145 cm length double flexible tip 5 cmmarkings with nitinol core platinum tip and aq coating ofmicrothin layer of hydrophillic polymer, 365 micrometerslimline laser fibre for lumenis holmium laser ref no0624 148 36, 550 micrometer slimline laser fibre forlumenis holmium laser ref no 0624 149 55, ureteralaccess sheath 12 obq 14 fr 36cm, ureteral access sheath12 obq 14 fr 46 cm, urethral dilator set from 6 fr through22 fr, needle, 200 micrometer slimline laser fibre forlumenis holmium laser, amplatz renal dilator setconsisting if an 8 fr radiopaque tfe catheter threeradiopaque dilators 6point0 to 10point0 fr, laparoscopicneedle holder parrot jaw 5 mm dia 30 to 36 cm long withratchet and 5 mm long straight working end obq blades, laparoscopic needle holder 5 mm dia 30 to 36 cm long withratchet and 5 mm long curved working end obq blades, 100percent silicone foleys catheter 2way 12f bis andequivalent, laparoscopic sterile disposable veress needle120mm, non siliconised foleys urinary catheter 2way 16 fwith colour coding at balloon end, high frequency 24 fr0point2 wire medium 30 degrees sterile disposableresection electrode loop single stem olympus, retrievalforceps alligator 3 fr 115 cm rigid, retrieval forcepsalligator 7 fr 40 cm rigid, urinary bladdercatheterisation set sterile pack consisting of all silicone 2way foleys cathter 16f sterile gloves 7point5, double jureteric silicone stent 4point7 to 5 fr 26 cm length, nelaton personal cic catheter 12 f, nelaton personal ciccatheter 14 f, nelaton personal cic catheter 16 f, double jstent with positioner 26 cm 4point7 obq 5 fr, double pigtailureteric stent set black silicone 6 fr obq 26 cm, uwsolution for organ preservation, disposable suctionirrigation set for lap surgery, non siliconised foleys urinary //bid details2 / 40 catheter 2way 18 f with colour coding at balloon end bisand equivalent, ureteric catheter 70 cm open end size 4 fr

State Government

TRN :35653275 | 05 Nov, 2025

Tender Value : 0

Latur - Maharashtra

Tender for supply medicine, surgical and chemical kits items - tab.amitriptyllin 25mg tab.amlodipin 5mg cap.amoxycillin 500mg tab.amoxy 500+clavulanic acid 125 tab.ascorbic acid 100mg tab.aspirin 75mg tab.atenelol 50mg tab.atrovastatin 10mg tab.azithromycin 500mg tab.calcium lactate +vit d3 tab. carbamazepine 200mg tab.cetrizine 10mg tab. ciprofloxacin 500mg tab.clonazepam 0.5 mg tab.diclofenac sodium 50mg cap.doxycyllin 100mg tab.escitalopram 10mg tab.fluconazole 150mg tab.frusemide 40mg cap.iron & folic acid (ferofolla) tab. itroconazole 100mg tab. ivermectine 12mg tab. isorbitrate 10mg tab. labetalol 100mg tab. lorazepam 2mg tab.metformin 500mg tab.metronidazole 400mg tab.misoprostal 200mcg cap. multivitamin tab. nefidepin 10mg tab.norflox 400mg tab.olenzapine 5mg tab.pantoprazole 40 mg tab.paracetamol 500mg tab.phenytoin sodium 100mg tab.prednisolone 5mg tab. sertaline 100mg tab.salbutamol 4mg tab.sodium valproate 200mg tab.trihexyphenidyl +trifluperazine tab.clopidogrel 75mg tab.glimipride 1gm (inj. & iv ) adrenaline bitartrate inj 1 mg/ml adenosine inj. amikacin inj 500mg 2ml amiodarone injection amoxycilline with clavulanic acid inj 1.2 gm anti rabies serum 1500iu inj anti rh d inj 300 mcg anti rabies vaccine 1ml atracurium 2.5ml asyclovir 500mg inj. atropine inj 1ml inj. asvs bupivacaine + dextrose 4ml butrophenol inj buprenorphine inj caffiene inj. calcium gluconate 10ml carboprost 250mcg cefotaxime 1gm injection clindamycin 600mg injection colisthimithate 10lakh iu inj. dexamethazone inj 2ml dexmedetomidine inj deriphylline 2ml inj. diclofenac sodium 1 ml injection diclofenac sodium 3 ml injection diltiazem injection diazipam inj dobutamine 5ml inj dopamine 5ml inj. drotavarine 40mg frusemide inj 2ml gentamycin inj glycopyrrolate inj 1ml haloperidol inj. heparin 25000iu inj. hyluronidase 1500iu inj. hydrocortisone sodium succinate inj 100mg hepamerz inj. human actrapid insuline 10ml iron sucrose 5ml ketamine inj. labetalol 20mg, 4ml inj low molucular heparine 0.6ml lignocaine hydrochloride 2% 30ml lignocaine with adrenaline(1:80000) 30ml levetiracetam 500mg inj lorazepam inj loxicard 4% 50ml inj. magnesium sulphate inj 2 ml menadione sodium bisulphite inj 1ml (vit k) mephentermine inj 10ml meropenum 1gm inj inj. methyl prednisolone 500mg(iv use) midazolam 10ml mucinac (n-acetyl cysteine) neostigmine inj 1ml noradrenaline 2ml inj. nitroglycerin octriotide 100mg inj ondonsetron 2mg inj. oxytocin 5iu/ml 1ml pantoprazole 40mg inj pentazocine lactate inj 1ml inj. phenobarbotone phenaramine maleate inj 2ml phenytoine sodium inj 2ml piperacillin sodium 4gm + tazobactam inj potassium chloride inj 10ml pralidoxime chloride inj 500gm promethazine hcl inj propofol 10ml inj. ropivcaine 20ml. rituximab 500mg/50ml injection sodium bicarbonate 10ml sodium valporate inj. streptokinase 15lac inj. succinyl choline tetanus immunoglobuline 500iu inj. tetanus toxoid 5ml tetanus toxide 0.5ml tramadol 50mg inj. tranexamic acid inj thiamine inj. valenthamide bromide inj vancomycine 1gm inj. vecuronium 4mg inj. iv human immunoglobulin 5%, 100ml iv human albumin 20% hepatetis b immunoglobulin 100iu iv amino acid 500ml iv fat emulsion 250ml iv sodium chloride 0.9% 500ml iv sodium chloride 0.9% 100ml iv ringer lactate 500ml iv dextrose with sodium chloride 500ml iv ciprofloxacin 100ml iv metronidazole 100ml iv manitol 100ml iv linezolid 200mg/100ml inj. suggamadex(inj. reversal) iv glycine irrigation solutin 3liter iv sodium chloride solution 3liter jar iv livofloxacin 500mg/100ml iv paracetamol 100ml (liquid and orals)amoxy+potacium clavunic oral susp. 30ml antacid syrup betadine povidone iodine 5% solution 500ml budesunide respulses 0.5mg 2ml calamine lotion calcium phospate + vitd3 syp. 200ml carboxymethyl cellulose eye drop 10ml cetrizine syrup 30ml ciprofloxacin + dexamethazone e/d ciprofloxacin eye/ ear drop clobetasol ointment 30gm clotrimazole cream 15gm dinoprostone gel 30gm desflurane liquid 240 flurbiprofen eye drop 5ml formaldehyde solition 400ml glycerin ip hydrogen peroxide 100ml hydrogen peroxide+ silver nitrate 1 ltr. (sanishield) lignocaine jelly 2% 30gm liquid parafine 500ml liquid sevoflurane 250ml lulliconazole ointment magnesium sulphate 400gm miconazole nitrate cream 2% 15gm moxifloxacin eye drop 5ml multivitamin syrup paediatric o-d spirit 1000ml ondensetron oral solution paracetamol syrup 60ml polymeric biagonide 1000ml (sanihygen) potasium permagnate (kmno4) powder povidone iodine ointment 15gm sanidex opa 5 ltr jar saniquid -m 20 handwash saniquid-p/ benzalconium 500ml saniscrum -m silver sulphadiazine cream sodium hypochlorite 200ml sodium hypochlorite 5ltr. jar (medichlore) surgical spirit 500ml wax solvant ear drop 5ml zinc sulphate syrup 60ml proparacain eye drop 0.5% 5ml tropicamide + phenylephrine eye drop tropicamide eye drop 5ml silver sulphadiazine ointment 250gm framycetin sulphate cream 30gm surfuctant 3ml vial duoline respulses duphilac syp. (suture, sergical and dressing material)absorbent cotton wool i.p packet of 500 gm net bandage cloth as per schedule fii of drugs and cosmetics act 1940 than of 100cm x 20 mtrs. absorbent gauze cloth as per schedule f-ii of drugs and cosmetics act.1940 than of 90cm x 18 mtrs mask triple layer face (disposable) intravenous infusion set adult urine bag 2000 ml disposable catheter foleys self retaining 2 ways size-8fr catheter foleys self retaining 2 ways size-10fr catheter foleys self retaining 2 ways size-12fr catheter foleys self retaining 2 ways size-14fr catheter foleys self retaining 2 ways size-16fr catheter foleys self retaining 2 ways size-18fr disposable insulin syringe u-40/1 ml each disposable syringe sterile with needle 2 ml disposable syringe sterile with needle 5 ml disposable syringe sterile with needle 10 ml disposable syringe sterile with needle 50 ml elastic adhesive bandage with adhesive mass (ip/usp/bp.) weight nlt (not less than) 145 gsm % stretch-not less than 75%, % regain ?not more than 65% size 10 cm x 4 mtrs cannula intra venous with needle in cannula i.p. with injection port, with wings size-18g cannula intra venous with needle in cannula i.p. with injection port, with wings size-20g cannula intra venous with needle in cannula i.p. with injection port, with wings size-22g cannula intra venous with needle in cannula i.p. with injection port, with wings size-24g cannula intra venous with needle in cannula i.p. with injection port, with wings size-26g cannula intra venous with needle in cannula i.p. with injection port, with wings size-23g cannula intra venous with needle in cannula i.p. with injection port, with wings size-27g catheter suction disposable size-8fr catheter suction disposable size-10fr catheter suction disposable size-12fr catheter suction disposable size-14fr catheter suction disposable size-16fr catheter suction disposable size-18fr gloves latex examination size-medium gloves latex examination size-large gloves rubber sterile, powder free isi mark size-6.5 inch gloves rubber sterile, powder free isi mark size-7 inch gloves rubber sterile, powder free isi mark size-7.5 inch plastic gloves disposable ryles tube sterile disposable size-14fr ryles tube sterile disposable size-16fr ryles tube sterile disposable size-18fr sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-3 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-3.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-4 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-4.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-5.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-6.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-7 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-7.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-8 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-8.5 mm id infant feeding tube no. 7 infant feeding tube no. 8 plaster of paris bandages (ready made) size 15 cm x 2.7 m plaster of paris bandages (ready made) size 20 cm x 2.7 m adhesive tape cloth based with porous and hypoallergenic adhesive mass having uniform spiked impression size 10cm x 5mtr mask oxygen (adult) mask oxygen (paediatric) mask nebulizer adult mask nebulizer paediatric diaper adult disposable cap surgeon disposable evacuated tubes k2 edta with double cap 2 ml clot activator double cap non vacuum 4.0 ml (13 mm x 75 mm) evacuated tubes 3.2% buffered sodium citrate with double cap 2 ml tubes non vacuum disposable hiv kit autoclave indicator strip (label) pack of 100 lables (2.5 cm x 6 cm) oxygen nasal cannula adult oxygen nasal cannula neonatal rubber makintosh colour :green,blue, red, thickness-0.4mm, width 110cm. roll of 30 meters i.s.o. certified, isi markwidth cord clamp sterile biomedical waste container red colour 60 ltr. biomedical waste container yellow colour 60 ltr. biomedical waste container blue colour 60 ltr. biomedical waste container black colour 60 ltr. biodegradable bio medical waste bags colour red size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour yellow size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour blue size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour black size 33inch x 36inch 51 micron (per kg) airway plastic latex free size 3 airway plastic latex free size 4 airway plastic latex free size 5 dial flow regulator extension set venous extension line with 3way size-10cm venous extension line with 3way size-25cm venous extension line with 3way size-50cm venous extension line with 3way size-100cm venous extension line with 3way size-150cm j r circuit bain circuit adult ecg electrodes for adult ecg/ultrasonography jelly 250 ml central venous catheter kit size- 7 f x 16 cm type- triple lumen oxygen flow meter with rotameter & humidifier bottle abdominal drain kit 28 abdominal drain kit 30 abdominal drain kit 32 a.v.fistula needle set size 17g x 1 epidural anaesthesia set 16g epidural anaesthesia set 18g blood administration/ transfusion set drape disposable poly plain sheet 100cm x 150cm appron plastic disposable romovac drain set 12 f romovac drain set 14 f romovac drain set 16 f romovac drain set 18 f bactigauze (chlorhexidine gauze dressing) pack of 10 piece size- 10 cm x 10 cm picc line 22 colostomy bag dialyser adult hemodialysis tubing set lma [i gel] 3 lma [i gel] 4 lma [i gel] 5 bone wax (pack of 12 piece) collagen dressing 15cm x 30 cm (per piece) surgicel original 4 in x 8 in (12/box) skin stapler multidirectional 35 wides minivac drain 8 f minivac drain 10 f sideport 15 dg crescent 2.5 mm eye drape 70 cm x 70 cm (pack of 10) keratome blade 2.8 mm (chemical, diagnostic kits) glucose total bilirubin direct bilirubin sgot sgpt alkaline phosphatse total protein albumin urea creatinine total cholesterol triglycerides ldl cholesterol hdl cholesterol uric acid csf protein (microprotein) calcium phosphorus magnesium amylase lipase ckmb ldh ise module reagent na+/k+/cl-/li+ xl multical erba auto wash kit xl auto wash (a/al) erba norm erba path tubing kit pm kit h 360 dil-1 1 x 20 liters h 360 lyes- 3 x 500 ml elite h clean- 4 x 50 ml h-360 control l, n, h h-360 calibrator aspen ds diluent aspen m-6ld lyse aspen m-6fd dye aspen m-6lh lyse aspen m-6ln lyse aspen m-6fn dye aspen probe cleanser hbsag elisa kit (+10) hiv elisa 4 th gen.kit hcv elisa kit vdrl rpr kits (+10) antisera blood grouping kit abd igm (monoclonal) 3 x 10 ml denguecombo rapid test card hbsag rapid test card (antigen detection) (+10) abg cassette/strip calibration gas epoc bgem test card (pack of 25) syringe with needle 3 ml thermal roll 57 mm tsk gel b-thala his g8 filter element g8- thalassemia elution buffer kit hemolysis and wash solution (l) g 8 hemoglobin f & a2 control g 8 hemoglobin f & a2 calibrator ribbon, ebar printer bluing reagent hematoxylin 10x ssc solution, 2 l label, blank, flap, 540 roll lcs reaction buffer concentrate (10x) 10x ez prep solution, 2 l cell conditioning solution, cc1, 2l ultra view universal dab detection kit confirm anti-cd99 mouse mono confirm cytokeratin 20 rabit mono confirm anti-desmin (de-r-11) pab ventana anti-e cadherin (36) confirm cytokeratin 7 rabbit mono confirm anti-s100 (4c4.9) primary antibo ventana anti-p63 (4a4) mouse mono matrix gel card ahg (144 test) matrix liss solution (500 ml) uniplastin for prothromine time itinr cuvette formalin solution (37 to 40 %) xylene (sulpher free) micropipette tips 200 ul ethanol absolute alcohol paraffin wax confirm anti- pr (1 e2) confirm anti- er (sp1) pathway anti-her2/neu (4b5) rabbit mono confirm anti-ki-67 (30-9) rabbit monoclo confirm anti-p67 (d0-7) primary antibody lohexol dye 100ml

Central Government/Public Sector

TRN :35627464 | 03 Nov, 2025

Tender Value : 0

Hyderabad - Andhra Pradesh

Tender for gem bids for chandipura, anti chandipuravirus glycoprotein polyclonal antibody. size100 ug, anti chandipuravirus phosphoprotein polyclonalantibody.size 100 ug, anti chandipuravirus nucleoproteinpolyclonal antibody. size 100 ug, biotinylated goat antidash mouse igg secondary antibody, size 1 ml, biotinylatedgoat anti dash rabbit igg secondary antibody, size 1 ml, universal anti mouse and rabbit igg h and l with hrppolymer, size 6 ml, abc peroxidase standard staining kitfor ihc, size 4 ml, dab solution 10x, 25ml, stablesubstrate buffer 275 ml, anti cd68 antibody, clonalitymouse monoclonal, size 100 ug, anti cd3e antibody, size100 ug, anti alpha smooth muscle actin antibody, size 50ug, anti transgelin antibody pack size 20ug, goat antimouse polymer dash linked hrp secondary antibody size 20ml, 10x dab substrate kit for ihc 10x dab 25 ml, buffer250 to 300 ml

Central Government/Public Sector

TRN :35610361 | 04 Nov, 2025

Tender Value : 0

Multi Location - Multi State

Tender for supply of spares kit for prag polymer make air dryer of 3-phase electric loco.

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35614533 | 03 Nov, 2025

Tender Value : 0

Yelahanka - Karnataka

Tender for gem bids for trizol rna iso plus , la taq polymerase , primescript 1 strand cdna synthesis kit , item 1 , item 2

Central Government/Public Sector

TRN :35600144 | 01 Nov, 2025

Tender Value : 2.05 Crore

Lucknow - Uttar Pradesh

Tender for gem bids for ifa, cerebral protection wire 0point014 inch 150 cm with debris, electrolytically hydraulically detachable platinum coils 6, microcatheter braided two to tip marker steam shapeable, microcatheter metal braided construction high flow, evohco polymer opacified for embolisation onyx, drug elutingbeads for chemoembolization, biliary self expandingmetallic stents size 10 mm x 10 cm, retrievableintracranial stent with compatible delivery, 2point1 1point7f echelon 10 neuromicrocatheter nitinol, vascular plugassorted sizes with all accessories ce fda, 5 max ace 68reperfusion catheter kit penumbra pointthe, 6 fr highlyflexible intracranial support catheter for, balloon mountedcovered stents 5 12 mm of assorted, dual markermicrocatheter approved for intra cranial, indigo cat 8 kitinclude a indigo cat 8 cathrter b, intracranial dual lumenextracompliant balloon compatible, intra cranial dualmarker braided micro catheter approved, n snare tripleloop snare for retrieval of intravascular, flow divertor withatleast 46 72 nitinol strands with, endovascular snare forretrieval of foreign body from, catheter guiding braidedmulti segment construction, rf ablation electrode bipolarfor ablation zone upto 5, venous self expanding stent 12mm diam x 40 60mm long, 3 max reperfusion catheter, electrolytically detachable soft and ultra soft 3d coils, marker pigtail catheter /bid number: gem/2025/b/6745416* /dated: 11-10-2025 & & / bid document1 / 41

State Government

TRN :35601373 | 01 Nov, 2025

Tender Value : 93.00 Lacs

Anand - Gujarat

Tender for gem bids for boqbunchrecurring, guide-it mutation detection kit gibson assembly cloningkit in-fusion hd cloning plus ce monarch or genelutespin dna gel extraction kit monarch or genelute spinplasmid miniprep kit cathode buffer container anodebuffer container bigdye terminator v31 cycle sequencingkit 1 pop-7 polymer cdna synthesis kit sybr green kit guide-it complete sgrna screening system acquitypremier peptide csh c18 column acquity uplc beh c18column waters acquity column in-line filter mfei-hf kpni-hf pmli bglii ecori-hf saci-hf sali-hf sbfi-hf fastdigest acc65i fastdigest maubi 10x tris acetateboric acid dithiothreitol dtt cysteine dmso depc carbecillin disodium cefotaxime powder kanamycinesulphate monohydrate rifampicin streptomycin sulphate hygromycin b 2 4-dichlorophenoxyacetic acid indole-3-acetic acid indole-3-butyric acid picloram 6-bap kinetin zeatin ga3 l-glutamine l-proline nitro bluetetrazolium riboflavin sodium carbonate proteaseinhibitor cocktail hydrogen peroxide solution guaiacol trichloroacetic acid hypergrade for lc-ms lichrosolvmethanol hypergrade for lc-ms lichrosolv acetonitrile acetic acid aluminum chloride acrylamide crystals amino acid standard - waters boron trifluoride etherate n-a-benzayal-l-arginine ethyal ester hydrochloride p-cumaricacid trans cinamic acid caffeic acid chlorogenic acid dihydroxy toluene 3-5 dimetoxi-4-hidroxicinamic diosgenin diethyl pyrocarbonate dithiothreitol 100 bpdna ladder-dye plus o-dianisidine l-dopa trans ferulicacid 99 alpha-glucosidase 4-hydroxy -3 methoxy benzoicacid jasmonic acid maltose mercuric oxide red myricetin nitroblue tetrazolium chloride napthyl acetate narginine papain phenyl methane sulphonyl fluoride protease phenazine methosulphate quarcetin saponin bid number gem2025b6772281 dated 11-10-2025 bid document1 130 0 0 sybr premix - tli rnas h plus, syringic acid, sinapic acid, sodium arsenate dibasic hydrate, 37 components fame mix, 2 3 5- tri phenyl tertazolium bromide, 2 4 6-tris 2-pyridyl-s-triazine, tannic acid, nnnn-tetramethyl ethylenediamine, vanilic acid, water sterile nuclease free, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phytic acid assay kit, trypsinactivity assay kit, 2 2-diphenyl-1-picrylhydrazyl, meta-phosphoric acid, amylose, l-amino acid assay kit, n-benzoyl-dl-arginine-p-nitroanilide bapa, trypsin - porcinepancreatic, methanol hplc grade, pancreatin, pepsin, potassium thiocyanate kscn, tannic acid standard, vanillin, tri chloro acetic acid, tris base, anthrone, hppvessel gasket, hpp sensor probe, pectinase, cellulase, phytic acid assay kit, tannin microplate assay kit, saponinmicroplate assay kit, n benzoyl-dl-arginine p-nitroanilidehydrochloride, trypsin solution, phosphotungsticphophomolybdic acid, neutrase, orthophthaldehyde, 2-mercaptoethanol, l-glutathione, l-serine, ultra centrifugalfilter 3 k da mwco, alpha glucosidase, ace inhibitoryactivity assay, indophenol dye, betacyanin, tuning andperformance standards for lc ms, methyl myristate, linolenic acid methyl ester, amino acid kit, 3 5-dinitrosalicylic acid reagent, p-nitrophenyl a-d-galactopyranoside, trypsin edta, acrylamide, n n-methylene bis-acrylamide, n n n n-tetramethylethylenediaamine, fluorometric, l-tyrosine, antimicrobial susceptibility test discs, mcfarlandstandard, phenol chloroform isoamyl alcohol, listeriamonocytogenes detection kit, dna ladder 100 bp, glycine-sodium hydroxide buffer, potassium acetate, betanin, quercetin, kaempferol, 96-well polystyrene microtiterplate, indicaxanthin, 2 2-diphenyl-l-picrylhydrazyl, proteinstandards for electrophoresis, acarbose extrapure, trisacetate edta buffer, tris borate edta buffer, listeriamonocytogenes atcc 700301 lyophilized culture, listeriamonocytogenes atcc 700302 lyophilized culture, papayamosaic virus elisa kit, papaya ringspot virus elisa kit, papaya leaf curl virus elisa kit, soybean mosaic viruselisa kit, urdbean crinkle virus elisa kit, mungbeanyellow mosaic virus elisa kit, okra enation leaf curl elisakitguide it mutation detection kit, gibson assemblycloningkit, in fusion hd cloning plus ce, monarch or genelute spindna gel extraction kit, monarch or genelute spin plasmidminiprep kit, cathode buffer container, anode buffercontainer, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplcbeh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfihf, fastdigest acc65i, fastdigest maubi, 10x tris acetateboric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycinesulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2, 4 dichlorophenoxyacetic acid, indole 3acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade forlc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phyticacid assay kit, trypsin activity assay kit, 2, 2 diphenyl 1picrylhydrazyl, meta phosphoric acid, amylose, l amino

Central Government/Public Sector

TRN :35588488 | 30 Oct, 2025

Tender Value : 0

Bharatpur - Rajasthan

Tender for gem bids for macro tips 5ml, ammonium sulphate for plant tissue culture500 gm, calcium chloride dihydrate for tissue culture 500gm, sucrose for tissue culture 5 kg, sodium thiosulphateanhydrous extrapure ar 500 gm, agar tissue culture tested500 gm, wide mouth bottle ldpe, wide mouth squarebottle hdpe, jerrican hdpe, wash bottle new type, analytical long stem funnel pp, accupipet-starter kit, macro tips 5 ml, spinix- vortex shaker, spinwin mc-00micro centrifuge, nitrile gloves powder free, kimwipeswipes, test tube cap pp, planton, staining box pp, biohazard bags pp, autoclavable bags pp, 5-sulphosalicylicacid dihydrate acs, tris buffer for hplc 99 9, luria bertanibroth, luria bertani agar, n-hexane pure 99, agarosehigh eeo for molecular biology, citric acid anhydrousextrapure 99, sodium bicarbonate extrapure, 99, silica gelblue self indicating coarse 58 mesh, boric acid extrapure99 5, phytic acid sodium salt hydrate insp6 extrapure 70, polyethylene glycol 6000 powder peg 6000, isopropanolipa for molecular biology 99 8, custom dna oligos 25 nmolin tubes hpsf purification full yiedl lyophilized qc with ladi tof, custom dna oligos 25 nmol in tubes hpsf purification fullyiedl lyophilized qc with ladi tof a, custom dna oligos 25nmol in tubes hpsf purification full yiedl lyophilized qc withladi tof b, custom dna oligos 25 nmol in tubes hpsfpurification full yiedl lyophilized qc with ladi tof c, customdna oligos 25 nmol in tubes hpsf purification full yiedllyophilized qc with ladi tof d, longamp taq dnapolymerase 500 units, q5 high-fidelity dna polymerase -100 units, ecori - 10000 units, bamhi - 10000 units, hind-iii-hf - 10000 units, bsai-hf v2 - 1000 units, primescrip 1ststrand cdna synthesis kit, e coli dh5 competent cells, ecoli dh5 competent cell, mighty cloning reagent set bluntend, mighty cloning reagent set blunt end s, waternuclease free, murashige skoog medium w o sucrose agar, hwso9, hwg09, salicyclic acid, indole-3-acetic acid iaa, 6-aminopurine vitamin b4, gibberellic acid ga3, jasmonic acid, ethephon, generuler 50 bp dna ladderready-to-use 50 g, generuler 1 kb dna ladder 5 x 50 g, dntp set 100 mm solutions 4 x 1 ml, dreamtaq dnapolymerase 500 u, 6x dna loading dye 5 x 1 ml, waternuclease-free 4 x 1 25 ml, water nuclease free 30 ml, phusion high-fidelity dna polymerase 100 u, 0 510 luniversal fit gentip natural, bulk low retention non sterile, 100 1000 l universal fit gentip natural, bulk bevelled lowretention non sterile, 0 2ml clear 96 well pcr plate noskirt high profile, sealing mat for 96 pcr plate white, storage rack for 1 5 2 0ml tubes assorted 100 well, autoclave bags 415 x 600mm, centrifuge tube with capconical, sterile racked, 25 well pc rack, micro tube rack1 5 ml, digital micro pipette, tips for gensleek-10000 clear, parafilm m sealing film, silicone lab mat, magbox, cubetube rack, adapt-a-rack, floating microtube rack, sample container, carboys with stopcock, 4-layer ppactivated carbon lab mask, tough-tags, thermo-labservesoft blue nitrile gloves, thermo-labserve soft blue nitrileglove, kimberly-clark purple nitrile gloves-m, safeskinpurple nitrile gloves-l, ethanol molecular biology grade, autoclavable bag, accupipette 1 5ml, moisture proofbottle with inner lid 1 litre, cuvettes disposable 4ml, testtube basket 160 160 160 mm, face mask, porcelainbuchner funnel, ceramic heater quartz tube-4l, doubledistillation unit 2 5 lph with quartz heater, ceramic //bid details2 / 61 heater quartz tube 2 5 l accs, circulating water bath 12ltr, magnetic stirrers heat stir, hot plate, glass dryer

Related Searched Keywords : polymer kit

List of polymer-kit Tenders

Tender for supply of spares kit for prag polymer make air dryer of 3-phase electric loco.

Tender for gem bids for trizol rna iso plus , la taq polymerase , primescript 1 strand cdna synthesis kit , item 1 , item 2

Get polymer kit Tender Alert...

Related Searched Keywords : polymer kit

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us