Indian Tenders Tender information of India
Global Tenders International Tender information
Projects Project information of India
Tender Awarded Tender awarded information
Sub-Contractor Vendor information of India
Pay Online
Register now
Login
Contact Info All India : 9276083333 / 9274315555 South India : 9274315555

Filters

List of glucose Tenders

List of latest glucose Tenders in Indian Tenders. Click on any glucose Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for glucose Tenders.

All-Tenders (64)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35608251 | 25 Oct, 2025

Tender Value : 28.94 Lacs

Agra - Uttar Pradesh

Tender for gem bids for mh, ibuprofen 200 mg tab, povidone iodine 10percent solutionbott of 100 ml, tinidazole 500 mg tab, paracetamol 325mg plus diclofenac sodium 50 mg tab, roxithromycin 150mg tab, albendazole 400 mg tab, ofloxacin 400 mg tab, losartan 25 mg tab, losartan 50 mg tab, diclofenac 25mgperml ip 3 ml inj, ibuprofen 400 mg tab, aceclofenac100 mg tab, levofloxacin ip 250 mg tab, ciprofloxacin500 mg plus tinidazole 600 mg tab, fluconazole 150 mgcappertab, inj cefoperazone 500 mgplus sulbactum 500mg vial, inj benzathine penicillin 12 00 000 i.u. vial, povidone iodine 5percent ointment 250 gm jar, ranitidine150 mg tab, vitamin b complex with a minimumconcentration of vit b1-5mg vit b6-3mg and vit b12-5mcgtherapeutic tabpercap, diclofenac gel 1percent tube of 30gm, amikacin sulphate 250 mgper2 ml inj, cefotaximesodium 1gm inj, ceftazidime 1 gm inj, ceftriaxone 1 gm inj, cefuroxime 250 mg tab, cefixime 100 mg tab, doxycycline cap 100mg, gentamycin sulphate inj imperiv40mgperml 2 ml inj, azithromycin 500 mg tab, meropenem 500 mg inj, inj amikacin sulphate 250mgperml, adhesive plaster zinc oxide 2.5cm x 1mtr, bandage triangular, compression elastic bandage for dvtsmall, compression elastic bandage for dvt medium, compression elastic bandage for dvt large, lint absorbentcotton, adjustable arm pouch sling large medium andsmall, foleys balloon catheter 2 way silicon 16g, foley surinary catheter siliconeperantibacterial coated 3 way size-14, foley s urinary catheter siliconeperantibacterialcoated 3 way size -16, foley s urinary cathetersiliconeperantibacterial coated 3 way size -18, glucostripsone touch select bott 50 tripsferopenem 200mg tab, flupentiol 0.5mg + melitrxcen 10mgtab, flupirtine 100 mg er tab, fungal diastase 50 mg tab, /bid number: gem/2025/b/6741185* /dated: 11-10-2025 & & / bid document1 / 59 ginko biloba 120mg tab, gliclazide 80 mg tab, glimepride2mg + metformine 500 mg tab, glimepride 1mg +metformine 500 mg tab, glimepride 2mg + metformine sr1gm tab, glucosamine 500mg + diacerin 50mg tab, glycopyrolate 2 mg tab, iguratimod 25 mg tab, imipramine25 mg tab, lacosamide 100 mg tab, lacosamide 200 mgtab, lacosamide 50 mg tab, levetiracetam 250 mg tab, linagliptin 2.5 mg +metformin 1000 mg tab, linagliptin 2.5mg +metformin 500 mg tab, loratidine 10 mg tab, mebeverine 200 mg tab, megesterol acetate 80 mg tab, melalatonin 3 mg tab, mesalamine 1.2 gm tab, methylcobalamin 500 mcg tab, methylprednisolone 8 mgtab, mifenamic acid 250mg + tranexamic acid 500mg tab, moxonidine 0.2 mg tab, moxonidine 0.3 mg tab, nifedipine10 mg sr tab, nifedipine r 20 mg tab, nitroglycerine 6.4 mgtab, olmisartan 40mg + hydrochlorthiazide 12.5 mg tab, posaconazole 100 mg tab, rifaximine 400 mg tab, rosuvastatin 10 mg tab, rosuvastatin 40 mg tab, safinamide 50mg tab, selegilne 05 mg tab, serratiopeptidase 10 mg tab, simvastatin 10 mg tab, sitagliptin phosphate 50 mg tab, sofosbuvir 400 mg +velpatasavir 100 mg tab, tenilgliptin 20 mg tab, tenilgliptin20 mg+metformin 500 mg tab, tenofovir 300 mg +ajenamide 25 mg tab, thiocolchicoside 4 mg tab, tizanidine2 mg tab, tolperisone hcl 150 mg tab, topentadol 50 mgtab, torsemide 10 mg+spironolactone 25 mg tab, torsemide 20 mg tab, trifluoperazine 05 mg tab, trifluoperazine 05 mg +trihexiphenidyl 02 mg tab, ubiquinol 100 mg tab, vilazodone 20mg tab, tacrolimus0.1% w/w tacvido forte oint 20gm, trypsin 96mg+bromelain 180mg + rutoside trihydrate 200mg tab, ungacyclovir skin 5 % w/w tube of 5 gm, collagen peptide 40mg + sodium hyaluronate 30 mg tab, glucostrips foraccucheck active bott of 50 strips, hydrochlorothiazide 12.5mg tab, eye gel hydroxypropyle methyl cellulose 0.3% w/wbott of 10ml, megestrol acetate 160 mg tab, vit b121500mcg + alpha 100mg + myo 100mg + fa 1.5mg +selen 55mcg cap, naproxen 500 mg tab, nebivolol 2.5 mgtab, neomercazole carbimazole 10mg tab, neomycin+beclometahsone +clotrimazole e/d 5 ml, nepafenac0.3%w/v 5 ml ed, nitroglycerin 2.6mg tab, ointbeclomethasone + salicylic acid 20 gm tube, olanzapine 2.5mg tab, pancreatin 10000 iu tab, piracetam 400 mg tab, pregabalin 75 mg + nortriptyline 25 mg tab, rosuvastin 10mg + aspirin 75 mg +clopidogril 75 mg tab, rotacapfluticasone 100mcg + salmetrol 50mcg / dose, saxagliptin2.5 mg tab, serrratiopeptidase 5 mg tab, sertraline 25 mgtab, silodosin 4 mg + dutasteroide 0.5 mg tab, silodosin 8mg + dutasteroide 0.5 mg tab, silymarin 70 mg tab, sodium valproate 300 mg cr tab, sodium valproate500mg tab, spironocatone 25 mg +frusemide 20 mg tab, spironolactone 50 mg tab, syrup iron + folic acid bott of200 ml, sgpt kit of 5 x 20 ml, sgot kit of 5 x 20 ml, glucose test kit 2 x 200 ml, blood urea reagent 1 2x60ml& reagent 2 60ml, bilirubin total + direct reagent 1 2x60micro ltr and reagent 2 2x60 micro ltr, uric acid kit of 5x20micro ltr, serum creatinine, reagent 1 2x60ml reagent 22x60ml, triglycerids kit of 5x20 micro ltr, cholesterol kitof 5 x 20 ml, urine sugar strips, each bottle of 100 strips, typhidot box of 50 test, total protein kit of 5x50ml, alkalinephosphate kit of 10x2.2 micro ltr, calcium kit of 5 x 20micro ltr, albumin kit of 5 x 50 ml, widal kit of 5ml x 4, rafactor kit of 50 test, adhesive plaster, zinc oxide, 2.5cm x1mtr, trioxsalen 25 mg tab, valacyclovir hydrochloride 500 //bid details2 / 59

Central Government/Public Sector

TRN :35608290 | 21 Oct, 2025

Tender Value : 0

Sonitpur - Assam

Tender for gem bids for erba multical xl kit system pack for em 360 , erba norm kit control system pack for em 360 , erba path kit control system pack for em 360 , erba wash kit system pack for em 360 , erba cholestrol kit system pack for em 360 , erba albumin kit system pack for em 360 , erba glucose kit system pack for em 360 , erba alp kit system pack for em 360 , pm kit for erba chem 5x

Central Government/Public Sector

TRN :35609424 | 21 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for echs, cough lozenges cremaffin liquid paraffin 125mgmagnesium hydroxide 375mg sodium picosulphate33mg 170 ml syp cyproterone 2mg ethinylestradiol 0035mg tab dabigatran 150 mg tab daflon 500mg diosmin 450mg hesperidin 50mg tab dapagliflozin 10 mg tab deflazacort 6 mg tab desensitising paste stannous fluoride or potassiumnitrate or sod monofluorophosphate tube of 50gm desvenlafaxine 50 mg tab diacerein 50 mg tab diclofenac 50 mg paracetamol 325 mg tab diclofenac 50 mg serratiopeptidase 10 mg tab diclofenac gel 1 percent diclofenac spray bottleof 40 gm dicyclomine 10mg mefenamic acid 250mgtab digoxin 025 mg tab diltiazem 60 mg tab diltiazem 90mg sr tab disodium hydrogen citratesyrup divalproex 500 mg tab domperidone 10 mgtab donepezil 5 mg tab donepezil 5mg memantine10mg tab dorzolamide 2 percent timolol 05percent eye drop doxophylline 400 mg tab doxycycline 100mg cap dressing sterile adhesive drotaverine 80 mg tab duloxetine 20mg cap eardrop chloramphenicol 5 percent clotrimazole 1percent betamethasone 025 percent lignocaine hcl2 percent in bottle of 5 ml ed ciprofloxacin 03percent ed loteprednol 05 percent moxiflox 05percent ed moxifloxacin and dexamethasone ednepafenac 01percent empagliflozin 10mg tab eplerenone 25 mg tab escitalopram 10 mgclonazepam 05 mg escitalopram 10mg tab esomeprazole 40 mg tab etizolam 05mg tab etodolac 400 mg tab etophyllin 115 mg thiophyllin35 mg sr 150 mg tab etoricoxcib 90mg tab etoricoxib 60 mg tab evening promrose 1000 cap bid number gem2025b6737084 dated 11-10-2025 bid document1 86 0 0 eye drop tobramycin0.3 percent 5 ml, ezetimibe 10mg tab, faropenem sodium 200 mg tab, febuxostat40mg tab, fenofibrate 145 mg tab, fenofibrate 200mg tab, ferrous fumarate folic acid tab or cap, fexofenadine 120 mg montelukast 10mg tab, fexofenadine 120mg tab, fluconazole 150 mg capor tab, flunarizine 10 mg tab, fluoxetine 20mg tab, flupentixol 0.5 mg melitracen 10 mg tab, folicacid 5 mg tab, formoterol 12mcg budesonide400mcg rotacap, formoterol 6mcg budesonide200mcg rc, formoterol 6mcg budesonide 400mcgrotacap, fourderm cream chlorhexidinegluconate 0.20 percent, clobetasol topical 0.05percent, miconazole topical 2 percent neomycintopical 0.5 percent 30 gm, framycetin sulphatecream bp 1 percent cream 15 or 20 gms, frusemide20 mg spironolactone 50 mg tab, frusemide 40 mgtab, fusidic acid oint orcream 15 gm, gabapentin100mg tab, gabapentin 300 mg methylcobalamin 500mg tab, gabapentin 300mg tab or cap, gammabenzene hexachloride 1 percent cetrimide 0.1percent lotion 100ml, ginkgo biloba tab, gliclazide 60 mg mr tab, glimepiride 2 mg metformin500 mg sustained release tab, glimepride 1 mgmetformin 500 mg tab, glimipride 1 mg metformin500 mg piog 15mg tab, glucosamine 500 mgchondriotin 400 mg tab, glucosamine 500 mg tab, glucosamine 750 mg diacerine 50 mg msm 200 mg tab, glucosamine sulphate 750mg metyulsulphonylmethaone 200mg oxydents and minerals, glucose powder, glutathione 500 mg tab, glycerylnitrate 2.6 tab, glyceryl nitrate 6.4 tab, gum paint15 ml, hydrochlorothiazide 12.5 mg tab, hydroxychloroquine 200 mg tab, hydroxyzine 25mg tab, imatinib 400 mg cap, indapamide sr 1.5 mgtab, indomethacin 75mg cap, inh budesonide 200mcg, inh ipratropium bromide 20mcglevosalbutamol 50 mcg mdi, inj cefotaxime sodium 1gm, inj ceftriaxone 1 gm, inj diclofenac 25mg perml 3ml, inj iron sucrose, inj methylcobalamin1000mcg vitamin b6 pyridoxine 100mgnicotinamide100mg, inj methylcobalamin 1500 mcg, inj rabipur vaccine 1 ml, insulin actrapid 100 iu perml, 3 ml pen, insulin highly purified isophane humannph 40iu per ml, 10 ml inj, insulin humalog lispro injrecombinan dna origin 100iu per ml cartidge, insulin premixed biphasic a 40 iu per ml 30 percenthuman neutral plus 70 percent human isophaneinsulin 10 ml inj, isabgol or ispaghula husk 3.5 gm, isosorbid mononitrate 20 mg tab, isosorbidedinitrate 10 mg tab, isosorbide dinitrate 5 mg tab, isosorbide mononitrate 30mg tab, isotonicglusose saline 500 mlcough lozenges, cremaffin 170ml syp, cyproterone2mg + ethinyl estradiol 0.035mg diane 35 tab, dabigatran 150 mg tab, daflon 500mg diosmin450mg + hesperidin 50mg tab, dapagliflozin 10 mgtab, deflazacort 6 mg tab, desensitising pastestannous fluoride/potassium nitrat tube of 50gm, desvenlafaxine 50 mg tab, diacerein 50 mg tab, diclofenac 50 mg + paracetamol 325 mg tab, diclofenac 50 mg + serratiopeptidase 10 mg tab, diclofenac gel 1% voveran , diclofenac spraybottle of 40 gm, dicyclomine 10mg + mefenamicacid 250mg tab, digoxin 0.25 mg tab, diltiazem 60 //bid details2 / 86

Central Government/Public Sector

TRN :35610379 | 23 Oct, 2025

Tender Value : 0

New Delhi - Delhi

Tender for supply of ami no.12.273/2025-26 continuous blood glucose monitoring device with reader

Central Government/Public Sector

TRN :35610402 | 21 Oct, 2025

Tender Value : 0

Jamalpur - Bihar

Tender for supply of glucose gluaq1-01 for fully biochemistry analyzer: meril autoquant 200 excellus.

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35612182 | 23 Oct, 2025

Tender Value : 93.1 Thousand

Ernakulam - Kerala

Tender for gem bids for glucose strips one touch verio , glucose strips gluco one morpen , trimetazidine hydrochloride extended release 80mg as pellets capsule , levosimendan 12.5mg inj , inj milrinone 10mg

Central Government/Public Sector

TRN :35612473 | 06 Nov, 2025

Tender Value : 0

Mumbai - Maharashtra

Tender for supply of inj i.v. containing amino acid, glucose, lipid 1000 ml.

Central Government/Public Sector

TRN :35614743 | 01 Nov, 2025

Tender Value : 0

Imphal - Manipur

Tender for gem bids for cap autrin pizer , cap becosule z aboott , tab b compex zevit , cap doxycycline hydrocloride 100mg , cap evion 400 mg , cap itraconazole 200mg , cap pantop dsr , cap tripsyn and chymotripsyn chymoral forte , tab aceclofenac plus serratiopeptidase plus paracetamol , tab albendazole 400mg , tab amlodipine besylate 5mg , tab amoxycillin 500mg clavulanic acid 125mg gsk , tab antacid chewable abbott , tab aspirin 75mg usv , tab atorvastatin 10mg , tab azithromycine 500mg alembic , tab bisacodyl 10 mg , tab calcium carbonate 500mg plus vit d3 shalcal , tab cefixime 200mg , tab cetrizine dihydrochloride 10mg , tab clopidogrel 75mg , tab combiflam sanofi , tab common cold sinarest , tab cough lozenges , tab cipzox cipla , tab diclofenac sodium 50mg novartis , tab dicyclomine hcl 20mg paracetamol 325mg , tab domperidone 10mg , tab fexofenadine 180mg sanofi , tab fluconazole 150mg , tab folic acid 5mg , tab glimepride 1mg , tab glucosamine 500 mg , tab indapamide , tab levocetrizine 5mg , tab limcee 500 mg , tab losartan 50mg , tab liv 52 , tab metformin sr 500 mg , tab methylcobalamine 1500mcg , tab montelukast 10mg levocetrizine 10mg cipla , tab metronidazole 400 mg , tab naproxen 250mg , tab norfloxacin 400mg , tab ondansetron 4mg , tab pantoprazole 40mg cipla , tab paracetamol 500mg dolo , tab paracetamol 650mg dolo , tab pheniramine maleate avil 25mg , tab pregabalin 75mg , tab pregabalin 75mg plus methylcobalamine 1500mcg , cap preprobiotic , tab rantac 150 mg , tab telmisartan 40mg , tab thyroxine 50 mcg , vaginal pessary clotrimazole 100mg , syp azithromycine 200mg 5ml 60ml , syp albendazole 10ml , syp amoxycillin clavulanic acid bott of 30ml , syp amoxycilline bott of 30ml , syp antacid gel each 5ml containing dried aluminium hyroxide gel 170ml , syp benadryl bott of 160 ml johnson johnson , syp b vitamin b compex multivitamin b 12 bott of 200 ml , syp calcium with vitamin d3 160 ml bott , syp cetrizine 60ml , syp chlorpheniramine maleate pcm phenylephrine 60ml common cold , syp cough expectorant 5ml containing diphenhydramine bott of 100ml , syp iron for adults with vitamins 200ml , syp lactulose bottle of 100ml dufalac , syp ofloxacine 100mg 5ml metronidazole200mg 5ml 30ml , syp ondansetron 2mg 5ml in 30ml , syp combiflam bott of 60 ml , syp paracetamol 250 mg , syp salbutamol 2mg 5ml bottle of 100ml , syp sucralfate bott of 200ml , drop dicyclomine simethicone 10 ml , mouth wash chlorhexidine 100ml colgate , oint diclofenac nanoforte gel tube of 30 gm , oint anti haemorhoidal , oint clindamycin phosphate 1 topical gel tube of 10gm , oint luliconazole 1 30gm , oint miconazole nitrate tube of 15gm , oint mouth ulcer gel , oint mupirocin 2 5gm , oint povidone iodine 5 tube of 10gm , oint silver sulphadiazine 1 tube of 15gms , oint clotrimazole tube of 15 gm , cream urea bott of 20 gm , cream sunscrean lashield , lotion calamine 100ml , lotion dynapar qps bott of 50 ml , gargle povidone iodine bott of 100 ml , spray analgesic voliny spray , liq povidone iodine 5 100ml , e d tear plus cmc refresh tear , e d ciprofloxacin dexamethasone 5ml cipla , e d moxifloxacin 05 5ml cipla , mouth paint clotrimazole bott of 5 ml , ear d waxsole bott of 15 ml , pdr clotrimazole 1 bott of 75mg , sachet calciferol 60000 iu cadila , sachet isabgol ispaghula husk 3 point 5gm , sachet oral rehydration salt ors 20 point 5g , inhalar seroflo 250 mcg , n d sodium chloride 0 point 65 15ml nasoclear , n d xylometazolidine 10ml adult , nd oxymetazoline hcl , disposable mask triple layer , dressing medicated adhesive 25cmx 6cm single strip pack band aid , bandage crepe15cm , hand sanitizer 100 ml bott , sanitary pad , steamer , nebuliser , bp apparatus digital , tennis elbow support size l andxl , tynor portable ortho heating pad , elbow support , ankle support , arm sling pouch , knee cap tynor size m and l , l s belt tynor size m and l , silicon heal pad tynor , walker , walking stick , wheel chair foldable , glucometer strips accucheck active bot of 50 , glucometer accucheck active , cervical collar tynor , powder protein 200gm , pdr glucose d pkt of 30 gm , lotion v wash bott of 100 ml , shampoo scalpe plus ketokonazole , tab sitagliptin 50 mg , tab tamsulosin 0 point 4 mg , syp liv 52 , tab meftal spas , tab zinc sulphate 20 mg , syp zinc 20 mg 5ml cap autrin pizer, cap becosule z, tab b compex zevit, cap doxycycline hydrocloride 100mg, cap evion 400 mg, cap itraconazole 200mg, cap pantop dsr, cap tripsyn and chymotripsyn chymoral forte, tab aceclofenac plus serratiopeptidase plus paracetamol, tab albendazole 400mg, tab amlodipine besylate 5mg, tab amoxycillin 500mg clavulanic acid 125mg gsk, tab antacid chewable abbott, tab aspirin 75mg usv, tab atorvastatin 10mg, tab azithromycine 500mg alembic, tab bisacodyl 10 mg, tab calcium carbonate 500mg plus vit d3 shalcal, tab cefixime 200mg, tab cetrizine dihydrochloride 10mg, tab clopidogrel 75mg, tab combiflam sanofi, tab common cold sinarest, tab cough lozenges, tab cipzox cipla, tab diclofenac sodium 50mg novartis, tab dicyclomine hcl 20mg paracetamol 325mg, tab domperidone 10mg, tab fexofenadine 180mg sanofi, tab fluconazole 150mg, tab folic acid 5mg, tab glimepride 1mg, tab glucosamine 500 mg, tab indapamide, tab levocetrizine 5mg, tab limcee 500 mg, tab losartan 50mg, tab liv 52, tab metformin sr 500 mg, tab methylcobalamine 1500mcg, tab montelukast

Central Government/Public Sector

TRN :35615140 | 23 Oct, 2025

Tender Value : 16.68 Lacs

Rampur Up - Uttar Pradesh

Tender for gem bids for dglp, bid number gem2025b6729350 dated 13-10-2025 bid document1 50 1 1 eppendrof tube 0.5 ml plastic pkt of 100, sample cupsystem pack for em 200 pkt of 500, xl - multical systempack for em 200 4 x 3 ml, autowash system pack forem 200 10 x 100 ml, urea system pack for em 200 5 x44 ml oblique 5 x 11 ml, xl autowash ac oblique al kitsystem pack for em 200 5 x 44 ml oblique 5 x 44 ml, control reagents for em 200 normal oblique norm 1 x 5ml, control reagents for em 200 high oblique path 1 x 5ml, creatinine - enzymatic system pack for em 200 5 x30 ml 5 x 10 ml, cholesterol system pack for em 200 10x 44 ml, triglyceride system pack for em 200 5 x 44 mloblique 5 x 11 ml, direct hdl system pack for em 200 4x 30 ml oblique 4 x 10 ml, uric acid system pack for em200 5 x 44 ml oblique 5 x 11 ml, bilirubin total systempack for em 200 6 x 44 ml 6 x 12.3 ml, bilirubin directsystem pack for em 200 6 x 44 ml oblique 6 x 12.3 ml, sgot - el system pack for em 200 6 x 44 ml oblique 6 x12.3 ml, sgpt - e system pack for em 200 6 x 44 mloblique 6 x 12.3 ml, alkaline phosphatase system packfor em 200 2 x 44 ml oblique 2 x 11 ml, amylase systempack for em 200 5 x 22 ml, lipase xl system pack forem 200 1 x 44 ml oblique 1 x 11 ml, ldh - p system packfor em 200 2 x 44 ml oblique 2 x 11 ml, ggt systempack for em 200 2 x 44 ml 2 x 11 ml, ckmb system packfor em 200 2 x 12 ml oblique 2 x 3 ml, cknac systempack for em 200 2 x 12 ml 2 x 3 ml, calcium a systempack for em 200 5 x 6 ml, magnesium system pack forem 200 2 x 44 ml, phosphorous system pack for em 2005 x 6 m, xl crp with calibrator system pack for em 2002 x 22 ml oblique 1 x 11 ml, contro h aso oblique rfoblique crp system pack for em 200 1 x 1 ml, contro laso oblique rf oblique crp system pack for em 200 1 x1 ml, hba1c with calibarator system pack for em 200 2 x15 ml oblique 2 x 5 ml oblique 5 x 0.5 ml, hba1c con hsystem pack for em 200 1 x 0.5 ml, hba1c con lsystem pack for em 200 1 x 0.5 m, ec cartridge s 250tfor ec 90 - next generation electrolyte analyser, ec 90urine diluent 1x100ml for ec 90 - next generationelectrolyte, diluent 20 ltrs for genrui automatedhematology analyser, l h lyse 200 ml for genruiautomated hematology analyser, diff lyse 500 ml forgenrui automated hematology analyser, cell clean, stromatolyser, h pylori detection rapid test kit, chikengunai detection rapid test kit, kit for estimation of cpk cknac 2x8 oblique 2x2 ml, kit for estimation of ck - mb 2x8obliuqe 2x2 ml, paracheck for pv or pf kit of 50 falcivax, rapid card screening for hbsag 50 test oblique kit, stripsalbumin and glucose bottle of 100 strips, d - dimer kit 25assay quantitative for sami auto analyser, c reactiveprotein kit for 50 tests, pap stain kit, disposable pap smearkit pack of 50 kits, typhi dot test kit 30 test oblique kit, dengue test kit 10 test oblique kit, leishmans stainrtu bottle of 500 ml, reticulocyte stain rtu bottle of 500ml, glucose god - pod system pack for em 200 10 x 44ml, cbc - dh hematology control for genrui kt 6610, probe cleaner 50 ml for gunuri automated, pt reagent kitof 25 tests, rapid card screening for hepatatis a hav 50test oblique kit, rapid card screening for hepatatis e hev50 test oblique kit, single blood collection bag 350ml, cellclean 1x50 ml

1
2
3
4
5
6
7

Related Searched Keywords : glucose

Get glucose Tender Alert...

Related Searched Keywords : glucose

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

Copyright ©2018 - Thetenders.com.