Filters

List of glucose Tenders

List of latest glucose Tenders in Indian Tenders. Click on any glucose Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for glucose Tenders.

All-Tenders (74)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35622989 | 31 Oct, 2025

Tender Value : 0

Doda - Jammu And Kashmir

Tender for gem bids for bunch, glass slide, esr pippette, blood group anticera a, bloodgroup anticera b, blood group anticera d, malaria rapidtest, urine for pregnancy, vdrl sts card, hiv card, hbsag card, hcv card, sample container, typhoid test, albumin kit, alk phosphate, bilrubin kit, calcium kit, capillaries tube, cholestrol kit, cover slip, creatanine kit, glucose kit, hdl direct, hemo spot, leishman stain, mantoux test vail, pap smear kit, sgot kit, sgpt kit, sodium citrate 3.8 tube, swab stick, total protein kit, triglycerdes kit, trop t kit, urea kit, uric acid, urine strip10 parameter, acetic acid, glucostrip, hb meter, hb strip

Central Government And Public Sector

TRN :35623067 | 25 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for glucose system pack reagent for bio-chemistry analyzer mindray bs -480 total cholestrol system pack reagent for bio-chemistry analyzer mindray bs-480 hdl cholestrol system pack reagent for bio-chemisrty analyzer mindray bs-480 ldl cholestrol system pack reagent for bio-chemisrty analyzer mindray bs-480 trigliceride system pack reagent for bio-chemisrty analyzer mindray bs-480 blood-urea system pack reagent for bio-chemisrty analyzer mindray bs-480 uric-acid system pack reagent for bio-chemisrty analyzer mindray bs-480 bilirubin-total system pack reagent for bio-chemisrty analyzer mindray bs-480 bilirubin-direct system pack reagent for bio-chemisrty analyzer mindray bs-480 sgot system pack reagent for bio-chemisrty analyzer mindray bs-480 sgpt system pack reagent for bio-chemisrty analyzer mindray bs-480 alkaline phosphatase system pack reagent for bio-chemisrty analyzer mindray bs-480 serum creatinine system pack reagent for bio-chemisrty analyzer mindray bs-480 cpk-nac system pack reagent for bio-chemisrty analyzer mindray bs-480 cpk-mb system pack reagent for bio-chemisrty analyzer mindray bs-480 ldh system pack reagent for bio-chemisrty analyzer mindray bs-480 calcium system pack reagent for bio-chemisrty analyzer mindray bs-480 total protein ystem pack reagent for bio-chemisrty analyzer mindray bs-480 phosphorus system pack reagent for bio-chemisrty analyzer mindray bs-480 amylase system pack reagent for bio-chemisrty analyzer mindray bs-480 albumin system pack reagent for bio-chemisrty analyzer mindray bs-480

Central Government/Public Sector

TRN :35623936 | 24 Oct, 2025

Tender Value : 14.3 Thousand

Darjeeling - West Bengal

Tender for gem bids for kit for estimation of glucose 2 into 200 ml , kit of estimation of triglyceride 5 into 20 ml , kit for estimation of cholestrol 5 into 20 ml , glucose god pod 10 into 44 ml system pack , cholestrol 10 into 44 ml system pack , triglyceride 5 into 44 oblique 5 into 11 ml system pack , cell pack erba h 360 diluent of 20 ltr , erba lyse 360 bott of 500 ml , cell clean h 360 bott of 50 ml , urine multistick strip bott of 100 strip , drabkins solution cane of 5 ltr , distill water cane of 5 ltr , urine container , pm kit for em 180 destiny , dengue rapid test kit of 10 test , salmonella typhi igg oblique igm test of 25 test , gerber test tube of 5 ml , parachek for pv and pf of 40 test , rapid card test pregnancy , strips albumin and glucose bott of 100 strips , d dimer kit of 10 test , rotor 150 cuvette 5 mm for em destiny 180 erba part code 202116

Central Government/Public Sector

TRN :35624906 | 27 Oct, 2025

Tender Value : 0

Dimapur - Nagaland

Tender for gem bids for kit of estimation of albumin 50ml bott 1box aspen company , antistreptolysin o test latex agglutination principle, complete with control serum aso , kits for estimation of alkaline phosphatase 5 x 20 ml erba , kit for estimation of bilirubin 2 x 60 ml erba , kits for estimation of creatinine 2 x 60 ml erba , kits for estimation cholesterol 5 x30 ml erba , liq glycerine , kits for estimation of glucose 200ml bott 1box aspen company , hiv i and ii rapid test kit of 10 test , hcv rapid card kit , kit for estimation of hdl cholesterol kit of 50 tests , leishman stain ready to use 1 x 500ml , paracheck test for malaria pv and pf , microtips in closed box of 96 tips 5ul to 200 ul, pack of 960 tips , microtips in closed box of 96 tips 100 ul to 1000 ul pack of 960 tips , pregnancy test card , kits for estimation of sgot ast 5 x 20 ml erba , kits for estimation of sgpt alt 5 x 20 ml erba , total protein test kit , kit for triglyceride estimation 1x50ml , kits for estimation of urea 5 x 20 ml erba , kits for estimation of uric acid 5 x 20 ml erba , keto diastix bott of 50 strips , blood group a b ab d reagent 10 ml each for a b o x 1box , dengue rapid test ns ag igm plus igs combo pack for 10 test , vaccum blood collection tubes with flash backe nedles edta 2ml 3ml , hydrochloric acid soln , ra factor rf latex kit 25 test , sterile urine container 50 ml pkt of 100 bott , vdrl test card kit of 10 test , wbc diluting fluid bott , disposal esr test tube , rapid card screening for hbv , rbc diluting fluide , red vial , kit for scrub typhus test , spirit 500ml , widal test kit 4x5 , disposable glucometer lancet for finger prick pkt of 100

Central Government/Public Sector

TRN :35608251 | 25 Oct, 2025

Tender Value : 28.94 Lacs

Agra - Uttar Pradesh

Tender for gem bids for mh, ibuprofen 200 mg tab, povidone iodine 10percent solutionbott of 100 ml, tinidazole 500 mg tab, paracetamol 325mg plus diclofenac sodium 50 mg tab, roxithromycin 150mg tab, albendazole 400 mg tab, ofloxacin 400 mg tab, losartan 25 mg tab, losartan 50 mg tab, diclofenac 25mgperml ip 3 ml inj, ibuprofen 400 mg tab, aceclofenac100 mg tab, levofloxacin ip 250 mg tab, ciprofloxacin500 mg plus tinidazole 600 mg tab, fluconazole 150 mgcappertab, inj cefoperazone 500 mgplus sulbactum 500mg vial, inj benzathine penicillin 12 00 000 i.u. vial, povidone iodine 5percent ointment 250 gm jar, ranitidine150 mg tab, vitamin b complex with a minimumconcentration of vit b1-5mg vit b6-3mg and vit b12-5mcgtherapeutic tabpercap, diclofenac gel 1percent tube of 30gm, amikacin sulphate 250 mgper2 ml inj, cefotaximesodium 1gm inj, ceftazidime 1 gm inj, ceftriaxone 1 gm inj, cefuroxime 250 mg tab, cefixime 100 mg tab, doxycycline cap 100mg, gentamycin sulphate inj imperiv40mgperml 2 ml inj, azithromycin 500 mg tab, meropenem 500 mg inj, inj amikacin sulphate 250mgperml, adhesive plaster zinc oxide 2.5cm x 1mtr, bandage triangular, compression elastic bandage for dvtsmall, compression elastic bandage for dvt medium, compression elastic bandage for dvt large, lint absorbentcotton, adjustable arm pouch sling large medium andsmall, foleys balloon catheter 2 way silicon 16g, foley surinary catheter siliconeperantibacterial coated 3 way size-14, foley s urinary catheter siliconeperantibacterialcoated 3 way size -16, foley s urinary cathetersiliconeperantibacterial coated 3 way size -18, glucostripsone touch select bott 50 tripsferopenem 200mg tab, flupentiol 0.5mg + melitrxcen 10mgtab, flupirtine 100 mg er tab, fungal diastase 50 mg tab, /bid number: gem/2025/b/6741185* /dated: 11-10-2025 & & / bid document1 / 59 ginko biloba 120mg tab, gliclazide 80 mg tab, glimepride2mg + metformine 500 mg tab, glimepride 1mg +metformine 500 mg tab, glimepride 2mg + metformine sr1gm tab, glucosamine 500mg + diacerin 50mg tab, glycopyrolate 2 mg tab, iguratimod 25 mg tab, imipramine25 mg tab, lacosamide 100 mg tab, lacosamide 200 mgtab, lacosamide 50 mg tab, levetiracetam 250 mg tab, linagliptin 2.5 mg +metformin 1000 mg tab, linagliptin 2.5mg +metformin 500 mg tab, loratidine 10 mg tab, mebeverine 200 mg tab, megesterol acetate 80 mg tab, melalatonin 3 mg tab, mesalamine 1.2 gm tab, methylcobalamin 500 mcg tab, methylprednisolone 8 mgtab, mifenamic acid 250mg + tranexamic acid 500mg tab, moxonidine 0.2 mg tab, moxonidine 0.3 mg tab, nifedipine10 mg sr tab, nifedipine r 20 mg tab, nitroglycerine 6.4 mgtab, olmisartan 40mg + hydrochlorthiazide 12.5 mg tab, posaconazole 100 mg tab, rifaximine 400 mg tab, rosuvastatin 10 mg tab, rosuvastatin 40 mg tab, safinamide 50mg tab, selegilne 05 mg tab, serratiopeptidase 10 mg tab, simvastatin 10 mg tab, sitagliptin phosphate 50 mg tab, sofosbuvir 400 mg +velpatasavir 100 mg tab, tenilgliptin 20 mg tab, tenilgliptin20 mg+metformin 500 mg tab, tenofovir 300 mg +ajenamide 25 mg tab, thiocolchicoside 4 mg tab, tizanidine2 mg tab, tolperisone hcl 150 mg tab, topentadol 50 mgtab, torsemide 10 mg+spironolactone 25 mg tab, torsemide 20 mg tab, trifluoperazine 05 mg tab, trifluoperazine 05 mg +trihexiphenidyl 02 mg tab, ubiquinol 100 mg tab, vilazodone 20mg tab, tacrolimus0.1% w/w tacvido forte oint 20gm, trypsin 96mg+bromelain 180mg + rutoside trihydrate 200mg tab, ungacyclovir skin 5 % w/w tube of 5 gm, collagen peptide 40mg + sodium hyaluronate 30 mg tab, glucostrips foraccucheck active bott of 50 strips, hydrochlorothiazide 12.5mg tab, eye gel hydroxypropyle methyl cellulose 0.3% w/wbott of 10ml, megestrol acetate 160 mg tab, vit b121500mcg + alpha 100mg + myo 100mg + fa 1.5mg +selen 55mcg cap, naproxen 500 mg tab, nebivolol 2.5 mgtab, neomercazole carbimazole 10mg tab, neomycin+beclometahsone +clotrimazole e/d 5 ml, nepafenac0.3%w/v 5 ml ed, nitroglycerin 2.6mg tab, ointbeclomethasone + salicylic acid 20 gm tube, olanzapine 2.5mg tab, pancreatin 10000 iu tab, piracetam 400 mg tab, pregabalin 75 mg + nortriptyline 25 mg tab, rosuvastin 10mg + aspirin 75 mg +clopidogril 75 mg tab, rotacapfluticasone 100mcg + salmetrol 50mcg / dose, saxagliptin2.5 mg tab, serrratiopeptidase 5 mg tab, sertraline 25 mgtab, silodosin 4 mg + dutasteroide 0.5 mg tab, silodosin 8mg + dutasteroide 0.5 mg tab, silymarin 70 mg tab, sodium valproate 300 mg cr tab, sodium valproate500mg tab, spironocatone 25 mg +frusemide 20 mg tab, spironolactone 50 mg tab, syrup iron + folic acid bott of200 ml, sgpt kit of 5 x 20 ml, sgot kit of 5 x 20 ml, glucose test kit 2 x 200 ml, blood urea reagent 1 2x60ml& reagent 2 60ml, bilirubin total + direct reagent 1 2x60micro ltr and reagent 2 2x60 micro ltr, uric acid kit of 5x20micro ltr, serum creatinine, reagent 1 2x60ml reagent 22x60ml, triglycerids kit of 5x20 micro ltr, cholesterol kitof 5 x 20 ml, urine sugar strips, each bottle of 100 strips, typhidot box of 50 test, total protein kit of 5x50ml, alkalinephosphate kit of 10x2.2 micro ltr, calcium kit of 5 x 20micro ltr, albumin kit of 5 x 50 ml, widal kit of 5ml x 4, rafactor kit of 50 test, adhesive plaster, zinc oxide, 2.5cm x1mtr, trioxsalen 25 mg tab, valacyclovir hydrochloride 500 //bid details2 / 59

Central Government/Public Sector

TRN :35608290 | 21 Oct, 2025

Tender Value : 0

Sonitpur - Assam

Tender for gem bids for erba multical xl kit system pack for em 360 , erba norm kit control system pack for em 360 , erba path kit control system pack for em 360 , erba wash kit system pack for em 360 , erba cholestrol kit system pack for em 360 , erba albumin kit system pack for em 360 , erba glucose kit system pack for em 360 , erba alp kit system pack for em 360 , pm kit for erba chem 5x

Central Government/Public Sector

TRN :35609424 | 21 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for echs, cough lozenges cremaffin liquid paraffin 125mgmagnesium hydroxide 375mg sodium picosulphate33mg 170 ml syp cyproterone 2mg ethinylestradiol 0035mg tab dabigatran 150 mg tab daflon 500mg diosmin 450mg hesperidin 50mg tab dapagliflozin 10 mg tab deflazacort 6 mg tab desensitising paste stannous fluoride or potassiumnitrate or sod monofluorophosphate tube of 50gm desvenlafaxine 50 mg tab diacerein 50 mg tab diclofenac 50 mg paracetamol 325 mg tab diclofenac 50 mg serratiopeptidase 10 mg tab diclofenac gel 1 percent diclofenac spray bottleof 40 gm dicyclomine 10mg mefenamic acid 250mgtab digoxin 025 mg tab diltiazem 60 mg tab diltiazem 90mg sr tab disodium hydrogen citratesyrup divalproex 500 mg tab domperidone 10 mgtab donepezil 5 mg tab donepezil 5mg memantine10mg tab dorzolamide 2 percent timolol 05percent eye drop doxophylline 400 mg tab doxycycline 100mg cap dressing sterile adhesive drotaverine 80 mg tab duloxetine 20mg cap eardrop chloramphenicol 5 percent clotrimazole 1percent betamethasone 025 percent lignocaine hcl2 percent in bottle of 5 ml ed ciprofloxacin 03percent ed loteprednol 05 percent moxiflox 05percent ed moxifloxacin and dexamethasone ednepafenac 01percent empagliflozin 10mg tab eplerenone 25 mg tab escitalopram 10 mgclonazepam 05 mg escitalopram 10mg tab esomeprazole 40 mg tab etizolam 05mg tab etodolac 400 mg tab etophyllin 115 mg thiophyllin35 mg sr 150 mg tab etoricoxcib 90mg tab etoricoxib 60 mg tab evening promrose 1000 cap bid number gem2025b6737084 dated 11-10-2025 bid document1 86 0 0 eye drop tobramycin0.3 percent 5 ml, ezetimibe 10mg tab, faropenem sodium 200 mg tab, febuxostat40mg tab, fenofibrate 145 mg tab, fenofibrate 200mg tab, ferrous fumarate folic acid tab or cap, fexofenadine 120 mg montelukast 10mg tab, fexofenadine 120mg tab, fluconazole 150 mg capor tab, flunarizine 10 mg tab, fluoxetine 20mg tab, flupentixol 0.5 mg melitracen 10 mg tab, folicacid 5 mg tab, formoterol 12mcg budesonide400mcg rotacap, formoterol 6mcg budesonide200mcg rc, formoterol 6mcg budesonide 400mcgrotacap, fourderm cream chlorhexidinegluconate 0.20 percent, clobetasol topical 0.05percent, miconazole topical 2 percent neomycintopical 0.5 percent 30 gm, framycetin sulphatecream bp 1 percent cream 15 or 20 gms, frusemide20 mg spironolactone 50 mg tab, frusemide 40 mgtab, fusidic acid oint orcream 15 gm, gabapentin100mg tab, gabapentin 300 mg methylcobalamin 500mg tab, gabapentin 300mg tab or cap, gammabenzene hexachloride 1 percent cetrimide 0.1percent lotion 100ml, ginkgo biloba tab, gliclazide 60 mg mr tab, glimepiride 2 mg metformin500 mg sustained release tab, glimepride 1 mgmetformin 500 mg tab, glimipride 1 mg metformin500 mg piog 15mg tab, glucosamine 500 mgchondriotin 400 mg tab, glucosamine 500 mg tab, glucosamine 750 mg diacerine 50 mg msm 200 mg tab, glucosamine sulphate 750mg metyulsulphonylmethaone 200mg oxydents and minerals, glucose powder, glutathione 500 mg tab, glycerylnitrate 2.6 tab, glyceryl nitrate 6.4 tab, gum paint15 ml, hydrochlorothiazide 12.5 mg tab, hydroxychloroquine 200 mg tab, hydroxyzine 25mg tab, imatinib 400 mg cap, indapamide sr 1.5 mgtab, indomethacin 75mg cap, inh budesonide 200mcg, inh ipratropium bromide 20mcglevosalbutamol 50 mcg mdi, inj cefotaxime sodium 1gm, inj ceftriaxone 1 gm, inj diclofenac 25mg perml 3ml, inj iron sucrose, inj methylcobalamin1000mcg vitamin b6 pyridoxine 100mgnicotinamide100mg, inj methylcobalamin 1500 mcg, inj rabipur vaccine 1 ml, insulin actrapid 100 iu perml, 3 ml pen, insulin highly purified isophane humannph 40iu per ml, 10 ml inj, insulin humalog lispro injrecombinan dna origin 100iu per ml cartidge, insulin premixed biphasic a 40 iu per ml 30 percenthuman neutral plus 70 percent human isophaneinsulin 10 ml inj, isabgol or ispaghula husk 3.5 gm, isosorbid mononitrate 20 mg tab, isosorbidedinitrate 10 mg tab, isosorbide dinitrate 5 mg tab, isosorbide mononitrate 30mg tab, isotonicglusose saline 500 mlcough lozenges, cremaffin 170ml syp, cyproterone2mg + ethinyl estradiol 0.035mg diane 35 tab, dabigatran 150 mg tab, daflon 500mg diosmin450mg + hesperidin 50mg tab, dapagliflozin 10 mgtab, deflazacort 6 mg tab, desensitising pastestannous fluoride/potassium nitrat tube of 50gm, desvenlafaxine 50 mg tab, diacerein 50 mg tab, diclofenac 50 mg + paracetamol 325 mg tab, diclofenac 50 mg + serratiopeptidase 10 mg tab, diclofenac gel 1% voveran , diclofenac spraybottle of 40 gm, dicyclomine 10mg + mefenamicacid 250mg tab, digoxin 0.25 mg tab, diltiazem 60 //bid details2 / 86

Central Government/Public Sector

TRN :35610379 | 23 Oct, 2025

Tender Value : 0

New Delhi - Delhi

Tender for supply of ami no.12.273/2025-26 continuous blood glucose monitoring device with reader

Central Government/Public Sector

TRN :35610402 | 21 Oct, 2025

Tender Value : 0

Jamalpur - Bihar

Tender for supply of glucose gluaq1-01 for fully biochemistry analyzer: meril autoquant 200 excellus.

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Related Searched Keywords : glucose

List of glucose Tenders

Tender for supply of ami no.12.273/2025-26 continuous blood glucose monitoring device with reader

Tender for supply of glucose gluaq1-01 for fully biochemistry analyzer: meril autoquant 200 excellus.

Get glucose Tender Alert...

Related Searched Keywords : glucose

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us