Filters

List of form Tenders

List of latest form Tenders in Indian Tenders. Click on any form Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for form Tenders.

All-Tenders (162)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35620105 | 04 Nov, 2025

Tender Value : 0

Angul - Orissa

Tender for gem bids for handling, transport and other mining services - percentagequote based - rate contract fy25-26 for excavation, loadingand transportation, unloading of ash form ntpc talcher tounloading at construction site of road projects of nhai andother cent..

Central Government/Public Sector

TRN :35620280 | 29 Oct, 2025

Tender Value : 0

Sealdah - West Bengal

Tender for supply of drug eluting balloon catheter sirolimous/paclitaxel, dia 2.0 mm to 4.0 mm & length 10 mm to 40 mm. ballon must be coated by specific technology on which the sirolimous/paclitaxel drug is coated and is released with minimum transit lost control drug degradable and better drug retention. minimum drug dose will be 175 microgram and drug carrier will be in phospholipid form.the original company brochure mentioning the range of sizes diameter & length and etc. should be submitted along with tender. warranty: replacement warranty against any manufacturing defect noted on the o.t. table.

Central Government/Public Sector

TRN :35621061 | 03 Nov, 2025

Tender Value : 0

Rajnandgaon - Chhattisgarh

Tender for gem bids for asset management services - vanity box, 2000 pcs;onsite, asset management services - towel, 2000 pcs;onsite, asset management services - comb, 2000 pcs;onsite, asset management services - nail cutter, 2000pcs; onsite, asset management services - bindi pack, 2000 pcs; onsite, asset management services -handkerchief2 unit, 2000 pcs; onsite, assetmanagement services - mirror, 2000 pcs; onsite, assetmanagement services - leaflet, 2000 pcs; onsite, assetmanagement services - pamphlet, 2000 pcs; onsite, assetmanagement services - information card, 2000 pcs;onsite, asset management services - marriageregistration form, 2000 pcs; onsite

State Government

TRN :35622423 | 30 Oct, 2025

Tender Value : 0

Pithoragarah - Uttaranchal

Tender for gem bids for warm shoes, football, athletic shoes spikes, runningshoes, foot ball shoes, boxing shoes, football stocking, football socks hulf cut, tracksuit training, sports shoestraining, cross tranining, weight lifting plate form

Central Government/Public Sector

TRN :35626317 | 05 Nov, 2025

Tender Value : 0

Ambala - Haryana

Tender for gem bids for dglp, bid number gem2025b6791427 dated 15-10-2025 bid document1 31 0 0 temporary anchorage device small head size 1.5 x 8mm, advansync appliance new, screw expansion small glenross, arch wire niti copper pre formed ideal arch for upper 0.016round, arch wire niti copper pre formed ideal arch forlower 0.016 round, arch wire niti copper pre formed idealarch for upper 0.016 x 0.022 rectangular, arch wire niticoper pre formed ideal arch for lower 0.016 x 0.022rectangular, arch wire niti copper pre formed ideal arch forupper 0.014 round, arch wire niti copper pre formed idealarch for lower 0.014 round, arch wire niti copper preformed ideal arch for upper 0.012 round, arch wire niticopper pre formed ideal arch for lower 0.012 round, bonding system direct no mix adhesive kit complete, archwire ss upper preformed ideal arch form 0.016 x 0.025 inchrectangular, arch wire ss lower preformed ideal arch form0.016 x 0.025 inch rectangular, orthodontic bands withbuccal tubes 018 roth pkt of 400, orthodontic bands withbuccal tubes 022 mbt pkt of 400, ss wires upper round016 ss pkt of 10, ss wires lower round 016 ss pkt of 10, niti wires upper 19 oblique 25 ss pkt of 10, niti wireslower 19 oblique 25 ss pkt of 10, ss wires upper 17oblique 25 ss pkt of 10, ss wires lower 17 oblique 25 sspkt of 10, ss wires upper 19 oblique 25 ss pkt of 10, sswires lower 19 oblique 25 ss pkt of 10, niti wires upper016 x 022 with curve of spee pkt of 10, niti wires lower016 x 022 with curve of spee pkt of 10, molar buccal tubesupper first molar bondable tubes for 022 mbt bracket, molar buccal tubes lower first molar bondable tubes for022 mbt bracket, molar buccal tubes upper second molarbondable tubes for 022 mbt bracket, molar buccal tubeslower second molar bondable tubes for 022 mbt bracket, tucker, elastic chain 15 feet spool short, elastic chain 15feet spool open long, orthodontic brush, forsus frd 29mm, active wedges oblique anatomical wedges, orthopaedic face mask petit type, preformed loop arch wiretma oblique ss 24-42 inter incisal distance, crimpablehook cross section 0.016x 0.022 inches, elastic rubberseparators

State Government

TRN :35608039 | 29 Oct, 2025

Tender Value : 8.00 Crore

Kanpur - Uttar Pradesh

Tender for gem bids for layer 2 access switch v2 q2, wireless access point v2q2, networking / server rack q2, small form - factorpluggable transceiver q2, cat6 4pair utp cable 305mtr inone box, cat6 4pair utp outdoor cable 305mtr in one box, information outlet cat 6, face plate with gang box, 1meter utp cat 6 patch cord, 3 meter utp cat 6patch cord, 24 port cat6 patch panel fully loaded, single mode fiber24 core armored unitube, 12 port fibre optic liu fullyloaded, 24 port fibre optic liu fully loaded, fibre patchcord sc-lc sm, duplex 2 meter, online ups 1 kva withminumum 15 minutes backup, hdpe pipe 40mm, 105x50mm dlp raceway with accessories, 80x50mm dlpraceway with accessories, 32 mm pvc heavy conduit withaccessories isi mark, 40 mm pvc heavy casing withaccessories isi mark, flexible pipe 25 40 mm, laying ofutp cable in raceway conduit casing hdpe, installationand termination of i o user side including i opunching, labelling and testing, installation of jack panelincluding i o punching, labelling and testing, installation offace plate and gang box including i o punching, labellingand testing, trenching for outdoor utp cables as perinstructions including digging, laying of hdpe pipes as perlaying instructions for outdoor utp cables including 32 40mm hdpe pipe, laying of fibre cable in hdpe pipes as perlaying instructions including hdr drilling, hdpe pipe, fibrepulling, route markers, pits etc., digging the concrete androad cutting, supply and installation 2 inch gi pole for theoutdoor access point, installation of rack 32 15 9u, installation of liu including 26 splicing, installation ofswitch, installation of access point, onsite networkengineer for 5 year support, construction of huts as perdesign provided

Central Government/Public Sector

TRN :35608921 | 05 Nov, 2025

Tender Value : 0

Howrah - West Bengal

Tender for procurement of form no. s&t dn/annex-ii..

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35613644 | 03 Nov, 2025

Tender Value : 0

Ajmer - Rajasthan

Tender for gem bids for stationr, carbon paper, all pin, 045 reynolds pen, use and throughpen, pencil 11 pak, rubber, sharpener, big stapler hp45, small stapler 10, pin large stapler24 6, small stapler pins10 no, rope bundle, ream a4, stamp pad, cutter 19 mm, high lighter, whitener, fevi stick, rubber band 100 grms, room entry register 200 pages, income register clockroom, income register gast house, room entry form, toilet income register, room chart, file cover cobra, attendance register 1nos

Central Government/Public Sector

TRN :35613799 | 13 Nov, 2025

Tender Value : 0

Danapur - Bihar

Tender for supply of budesonide 200 mcg + form.

Related Searched Keywords : form

List of form Tenders

Tender for gem bids for handling, transport and other mining services - percentagequote based - rate contract fy25-26 for excavation, loadingand transportation, unloading of ash form ntpc talcher tounloading at construction site of road projects of nhai andother cent..

Tender for gem bids for warm shoes, football, athletic shoes spikes, runningshoes, foot ball shoes, boxing shoes, football stocking, football socks hulf cut, tracksuit training, sports shoestraining, cross tranining, weight lifting plate form

Tender for procurement of form no. s&t dn/annex-ii..

Tender for supply of budesonide 200 mcg + form.

Get form Tender Alert...

Related Searched Keywords : form

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us