Filters

List of fish Tenders

List of latest fish Tenders in Indian Tenders. Click on any fish Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for fish Tenders.

All-Tenders (105)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

State Government

TRN :35626694 | 31 Oct, 2025

Tender Value : 2.37 Crore

Udhamsign Nagar - Uttaranchal

Tender for construction of modern fish landing center at haripura reservoir district udham singh nagar under pmmsy

State Government

TRN :35626722 | 31 Oct, 2025

Tender Value : 1.54 Crore

Udhamsign Nagar - Uttaranchal

Tender for construction of modern fish landing center tumariya reservoir district udham singh nagar under pmmsy

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35613076 | 07 Nov, 2025

Tender Value : 0

Chennai - Tamil Nadu

Tender for supply of manufacture and supply of 60 kg special fish plate for glued joint to rdso drg. no. t- 2572, alt 5..

State Government

TRN :35613228 | 01 Nov, 2025

Tender Value : 0

Aligarh - Uttar Pradesh

Tender for gem bids for surgical, bid number gem2025b6779554 dated 11-10-2025 bid document1 56 0 0 tumor biopsy bionet holding 8 inches, kidney tray large12 inches, kidney tray medium 8 inches, dural guardpatch, cranial manual drill set, bowl small 4 inches, towelclip 6 inches, nasal packing forceps 6 inches, needleholder 8 inches size 1.0, tooth forceps 8 inches, toothforceps 6 inches, non tooth forceps 8 inches, non toothforceps 6 inches, adson tooth forceps fine 6 inches, debakey forceps 6 inches, debakey forceps 8 inches, adson non tooth forceps fine 6 inches, raney clipapplicator 8 inches, b.p handle no.3, b.p handle no.4, mayo scissor straight 6 inches, mayo scissor straight 8inches, mayo scissor curved 6 inches, mayo scissorcurved 8 inches, metzenbaum scissor 6 inches, mosquitoartery forceps curved 5 inches, kelly forceps dandy 6inches, needle holder 6 inches 3.0, needle holder 8 inches3.0, bayonet forceps plain 8 inches, non traumaticsuction tip large length 8 inches, non traumatic suctiontip medium length 8 inches, non traumatic suction tipsmall length 8 inches, fish hook forceps, periosteum 6inches, micro hook retractor 8 inches, artery forcepscurved 6 inches, bipolar cautery forceps bayonet 7 inches, bipolar cautery forceps straight 7 inches, rongeurkerrison punch upcut no.1 length 10 inches, rongeurkerrison punch upcut no.2 length 10 inches, rongeurkerrison punch upcut no.3 length 10 inches, rongeurkerrison punch upcut no.4 length 10 inches, rongeurkerrison punch downcut no.1 length 10 inches, rongeurkerrison punch downcut no.2 length 10 inches, rongeurkerrison punch downcut no.3 length 10 inches, rongeurkerrison punch downcut no.4 length 10 inches, cushingretractor 7 inches, bone nibbler curved medium 10 inches, bone nibbler curved large 12 inches, elevator 6 mmcurved 8 inches, elevator 8 mm straight 8 inches, langenbeck retractor 10 inches, mallet with chisel 10inches, penfield elevator 7 inches no.1, penfield elevator 7inches no.2, penfield elevator 7 inches no.3, penfieldelevator 7 inches no.4, freer elevator 18.5 mm, freerelevator 20.5 mm, dural retractor cushing scoville 12inches, dural scissor 6 inches, spinal spatula 6 inches, spinal spatula 8 inches, dural forceps micro 6 inches, dural forceps micro 8 inches, micro scissor straight 6inches, micro scissor straight 8 inches, micro scissorcurved 6 inches, micro scissor curved 8 inches, microbayonet forceps 8 inches, brain cannula 4 inches, braincannula 6 inches, tumor biopsy bayonetted cutting 8inches

Central Government/Public Sector

TRN :35614020 | 04 Nov, 2025

Tender Value : 0

Ernakulam - Kerala

Tender for gem bids for ladle medium board paste wooden bucket ice spice box container cereal with lid 10kgs coning carafe 6 cups dish pie 20 cms dish pie 30 cms egg beater kettle tea electric 2 ltrs squeezer lime jar pickle glass with cover basket rations box salt can milk 5 ltrs counter balance spring 1-15 kgs machine mincing hand large mesher potato scoop flour hand mk ii strainer gravy round strainer rice 50 cms x 25.5 cms urn for tea/coffee ss 50 cups dish flat 25 cms dish preserve round bone china 16 cms jug cream bone china 250 ml bowl finger lable wine port lable wine sherry saucer tea earthenware bowl soup katori plate soup bone china plate tea bone china pot tea bone china 1 ltrs pot coffee bone china 1 ltrs saucer coffee bone china tumbler slicer fish

State Government

TRN :35604024 | 31 Oct, 2025

Tender Value : 1.94 Lacs

Dinajpur - West Bengal

Tender for sl 1 repairing of 3 nos cc road from 1 salimuddin house to govt sub marshal pump 2 ajaharul house to samad house 3 fish market to amu house under saiyadpur gp within harirampur ps

Central Government And Public Sector

TRN :35607133 | 03 Nov, 2025

Tender Value : 45.92 Lacs

New Delhi - Delhi

Tender for gem bids for joggled fish plate for uic 60 kg rail, screw clamp forjoggled fish plate for 60 kg rail in ballastless track of dmrcstructure

State Government

TRN :35602467 | 30 Oct, 2025

Tender Value : 0

Sibsagar - Assam

Tender for group-b supply of fish seed under pmmsy 2023-24 group-b supply of fish seed

State Government

TRN :35602500 | 30 Oct, 2025

Tender Value : 0

Sibsagar - Assam

Tender for supply of formulated fish feed under pmmsy 2023-24 supply of formulated fish feed

Related Searched Keywords : fish

List of fish Tenders

Tender for construction of modern fish landing center at haripura reservoir district udham singh nagar under pmmsy

Tender for construction of modern fish landing center tumariya reservoir district udham singh nagar under pmmsy

Tender for supply of manufacture and supply of 60 kg special fish plate for glued joint to rdso drg. no. t- 2572, alt 5..

Tender for sl 1 repairing of 3 nos cc road from 1 salimuddin house to govt sub marshal pump 2 ajaharul house to samad house 3 fish market to amu house under saiyadpur gp within harirampur ps

Tender for gem bids for joggled fish plate for uic 60 kg rail, screw clamp forjoggled fish plate for 60 kg rail in ballastless track of dmrcstructure

Tender for group-b supply of fish seed under pmmsy 2023-24 group-b supply of fish seed

Tender for supply of formulated fish feed under pmmsy 2023-24 supply of formulated fish feed

Get fish Tender Alert...

Related Searched Keywords : fish

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us