Filters

List of cell Tenders

List of latest cell Tenders in Indian Tenders. Click on any cell Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for cell Tenders.

All-Tenders (221)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35609221 | 03 Nov, 2025

Tender Value : 25.0 Thousand

Leh - Ladakh

Tender for gem bids for glow plug , main leaf front , leaf 5 , leaf 2 front , supply pump , temp gauge , big brg cell , bush king

Central Government/Public Sector

TRN :35609736 | 04 Nov, 2025

Tender Value : 0

Pune - Maharashtra

Tender for supply of replacement of fuel cell sensor.

Central Government/Public Sector

TRN :35609762 | 27 Oct, 2025

Tender Value : 0

Kozhikode - Kerala

Tender for gem bids for paint roller 4 inch, paint roller 7 inch, paint roller 9 inch, paint roller 6 inch, paint brush 4 inch, paint brush 2 inch, fiber dust brush, envelope cloth coated 12inchx 16inch, envelope cloth coated 10 inchx 14inch, envelope clothcoated 9inch x 12inch, envelope 10inch x 14inch, envelope 6inch x 12inch, envelope 4inch x 10inch, photocopier paper210 mm x 297 mm a4gsm85 gm2, photocopier paper210 mm x 325 mm a4gsm80 gm2, candle wax, teflon tape, tape insulation 25 mm steel grip, wondertape 2 inch, antirust spray, tape transparent 2inch, tapetransparent 1inch, paper napkin, door mat foot mat floor, grease lg 280, aqua bond, quick dry steel putty, wetsurface putty, pencil cell, m seal, safety gloves cloth, abrasive paper 230x280 mm, torch cell medium size, tube florescent led cfl, lamp cfl led, battery aa, varnish touch wood, bag biodegradable big 14inch x20inch, petroleum jelly, paint brush 3inch, paint brush 13 mm, paint brush 1inch, lip seal for fire hydrant, 9 v battery, soldering led, silicon sealant compound 300 ml tube, silicon cartridge water proof, sand paper grade200, bagbiodegradable medium 14inch x18inch, bag biodegradablesmall14inch x16inch, wire connection legs, rj45connection, wiper soft rubber, wind socks, teflon threadseal tape roll 12 mm length, tape transparent 38 mm, bucket plastic 20 ltr cap, bucket plastic 15 ltr cap, brushsteel wire, brush scrubbing large hard brush, batteryconnection legs, araldite adhesive, cable casing, clothbunting green, clip jubilee 4inch, clip jubilee, clip jubilee065inch 0875inch, cable tie, cable electric two corecopper 6a, cotton waste, brush sweeping hand, superspin mop refills, polish metal brass, duster cloth, featherbroom phool jadoo, cleaner white toilet harpic, cleaningliquid for utensils, hand towel, steel cleaning liquid, spinmop set, wiper long handle, cotton rags, brush withlong handle, scrubber with handle, bag biodegradable forgarbage, dust bin, detergent powder, soap liquid toilet, room freshener room spray, hand wash liquid, glasscleaner 500 ml, disinfectant fluid whiteblack phenol, pestseal hit sprayaerosol spray, distilled water, mug plastic

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35611720 | 03 Nov, 2025

Tender Value : 20.0 Thousand

Leh Ladakh - Jammu And Kashmir

Tender for gem bids for gasket kit, bearing set crank thrust, connecting rod std, main brg cell, big eng brg cell, valve exhaust, springtensioner, mountine engine front, valve inlet, gear leverkit

Central Government/Public Sector

TRN :35612515 | 03 Nov, 2025

Tender Value : 0

Nagpur - Maharashtra

Tender for gem bids for mud balance , hydraulic filter press with dead weight. , filter paper box , o-ring , 60 mesh screen , glass graduated cylinder , fluid cell rubber packing

State Government

TRN :35612696 | 03 Nov, 2025

Tender Value : 1.80 Lacs

Jaipur - Rajasthan

Tender for gem bids for load cell tool steel, capacity- 300kgf, adi artechmodel no- 60410, rudra sensor model no- rsl-410, load cell ss alloy capacity 300kgf, adi artechmodel no - 60410-ss rudra sensor model no - rsl-410ss

Central Government/Public Sector

TRN :35613569 | 03 Nov, 2025

Tender Value : 0

Lucknow - Uttar Pradesh

Tender for gem bids for uv, uv-vis spectrophotometer with 2 year warranty as perspecifications, 6 cell holder, 2 pairs of quartz cubettes- 3.5ml and 1 ml capacity, 2 pairs of glass cubettes- 3.5 ml and1 ml capacity, pc as per specifications along withcompatible ups 1kv or more with 30 min backup

Central Government/Public Sector

TRN :35613841 | 27 Oct, 2025

Tender Value : 0

Bangalore - Karnataka

Tender for supply of sulfolyser 1.5 ltr for sysmax 5 part xn sulfolyser 1.5 ltr for sysmax 5 part xn-550 cell counter.

Central Government/Public Sector

TRN :35614816 | 03 Nov, 2025

Tender Value : 0

Ajmer - Rajasthan

Tender for gem bids for splendor , 2no spindle , 4no spindle , plaques , plaques g , cpvc brass tee of inch , cpvc solvent 100ml , fnar , waste pipe , gi tee , bb cock with nozzle , football brass , 1 inch udiser socket upvc , by 1 inch elbow , toilet seat cover , rakebold set , cpvc pipe 2 inch , cpvc elbow 2inch , upvc 1 inch elbow , long body teb , bras valve , cpvc plan valve 1 inch , cpvc plan tee , cpvc brass , cpvc brass , m cell 70 rs wali , tank nippel , funer stand , cutter machine , wrench spanner 12 inch , wrench spanner 14 inch , wrench spanner 18 inch , wrench spanner 24 inch , wrench spanner 36 inch , chuddi making die full set , getting quail kawa pana , chuddi making tub , hammer , chini snatch small big , 1 set fix pana 12 to 20 , alenki set , screw driver set small , screw driver set big

Related Searched Keywords : cell

List of cell Tenders

Tender for gem bids for glow plug , main leaf front , leaf 5 , leaf 2 front , supply pump , temp gauge , big brg cell , bush king

Tender for supply of replacement of fuel cell sensor.

Tender for gem bids for gasket kit, bearing set crank thrust, connecting rod std, main brg cell, big eng brg cell, valve exhaust, springtensioner, mountine engine front, valve inlet, gear leverkit

Tender for gem bids for mud balance , hydraulic filter press with dead weight. , filter paper box , o-ring , 60 mesh screen , glass graduated cylinder , fluid cell rubber packing

Tender for gem bids for load cell tool steel, capacity- 300kgf, adi artechmodel no- 60410, rudra sensor model no- rsl-410, load cell ss alloy capacity 300kgf, adi artechmodel no - 60410-ss rudra sensor model no - rsl-410ss

Tender for gem bids for uv, uv-vis spectrophotometer with 2 year warranty as perspecifications, 6 cell holder, 2 pairs of quartz cubettes- 3.5ml and 1 ml capacity, 2 pairs of glass cubettes- 3.5 ml and1 ml capacity, pc as per specifications along withcompatible ups 1kv or more with 30 min backup

Tender for supply of sulfolyser 1.5 ltr for sysmax 5 part xn sulfolyser 1.5 ltr for sysmax 5 part xn-550 cell counter.

Get cell Tender Alert...

Related Searched Keywords : cell

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us