Filters

List of cd-case Tenders

List of latest cd-case Tenders in Indian Tenders. Click on any cd-case Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for cd-case Tenders.

All-Tenders (4)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35619277 | 04 Nov, 2025

Tender Value : 0

New Delhi - Delhi

Tender for gem bids for battery cable, external battary adopter box, hard case for rf cable, hard transit case centralunit, soft transit case -central unit, soft transitcase-antenna unit, soft transit case-pedestal unit, soft transit case-back up base frame, soft transitcase-primary antenna, soft transit case-cdu, softtransit case -quadripod, set of cables aslesha, quadripod earth peg, quadripod leg tie belt, vernier theodolite with tripod, lensat compass, hard transit case-accs1, hard transit case -accs 2, hard transit case -accs3, hard transit case -accs4, hard transit case-accs5, hard transit case-accs6, hard case transit accs 8, hard transit caseaccs7, hard transit case-quadripod, hard transitcase back up base frame and, hard transit caseantenna unit, hard transit case primary antenna, hard case-generator, aslesha ups, generatoroutput cable with junction, power cable, extension box /bid number: gem/2025/b/6684487* /dated: 14-10-2025 & & / bid document1 / 28

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35552151 | 27 Oct, 2025

Tender Value : 5.53 Lacs

Datia - Madhya Pradesh

Tender for gem bids for laboratory, 1 5 diphenylcarbazone 10x tbs tris buffer saline 1octanol 2 4dinitrophenylhydrazine 2 4dinitrophenylhydrozine ar 2 butanol 2 thiobarbituric acid abts substrate chromophore diammonium salt aceticacid glacial hi ar acetonitrile gr agar powderbacteriological grade alkalinity testing kit aluminiumchloride anhydrous ammonia solution 25 gr ammoniatesting kit ammonium ferric citrate brown ammoniumhydrogen carbonate extrapure ammonium nitrate ammonium persulfate amphotericin b amt anhydrousglucose aniline ar 2 ascorbic acid bacterial genomicdna purification kitsilica column based bapna benzaldehyde bhi broth brain heart infusion broth bismuth iiisulphate blood agar base infusion agar borax boron trifluoride methanol complex bradford reagent bromophenol blue indicator butylated hydroxytoluene bht calcium carbonate calcium chloride dihydrate calciumhydroxide carboxymethylcellulose sodium salt mediumviscosity 400 800 cps cdna synthesis kit chitosan fromshrimp shells chloramphenicol citric acid extra pureanhydrous cod liver oil copper ii chloride dihydratecrystal pure cucl2h2o copper oxide powder coppersulphate cupric sulphate anhydrous cuso4 cyclonexane di sodium hydrogen orthophosphate anhydrous na2hpo4sod phosp diabasic anhydrous dimethylformamide diphenylamine indicator disodiumethylenediaminetetraacetate dihydrate edta disodiumphosphate dl aspartic acid dl tryptophan dntp mix 10mm ec broth ellman s reagent epinephrine erythromycin antibiotics disc ethanol diluent for dnaextraction feno33 ferric chloride ferrocene c10 h10 fe ferrous ammonium sulphate ferrous sulfate ferrozinec20h13n4nao6s2 folin denis reagent formalin bid number gem2025b6705724 dated 06-10-2025 bid document1 99 1 1 formaldehyde sol 37 41 ar grade, gelatin from porcineskin type a, glutaraldehyde solution 25, glycerolanhydrous, glycine amino acetic acid, guanidinehydrochloride, guar gum, histamine dihydrochloride, hydrochloric acid 2, hydrogen peroxide 30, imidazole ar, indole, irgasan triclosan, iron iii chloride anhydrous, kanamycin sulphate, l ascorbic acid vit c extra pure, labolene, lauryl sulphate broth lauryl tryptose broth, lecithin soya 30, l hydroxyproline, liquor ammoniaammonia soln, lugol s iodine, macconkey agar, magnesium chloride hexahydrate, magnesium oxide ar, magnesium sulfate heptahydrate, maltodextrin plantculture tested, manganous sulphate, mercuric nitratemonohydrate extrapure ar, methanol, methyl orange, methylene blue, mimosine, n octanol, n n n ntetramethyl ethylene diamine temed, na2s2o3 0 1 nampules, naoh 1 n ampules, neomycin antibiotics disc, nhexonic acid caproic acid, nitric acid, nitrobenzene, novobiocinno 5 selective supplement, o chlorophenol 2chloro phenol, oxalacetic acid, oxalic acid dihydrate, papain purified from papaya latex 500 g, pcr master mix, peptone gelatin agar, petroleum ether, petroleum jelly, phenol, phosphate buffered saline pbs ph 7 4, phydroxydiphenyl, picric acid ar, p nmethylaminophenolsulphate, poly ethylene glycol mw 8000, potassiumacetate gr, potassium chloride, potassium dichromate, potassium dihydrogen phosphate, potassium hydrogeniodate, potassium iodide, potassium persulfate, potassiumsodium tartrate, potassium sorbate granular, potassiumthiocyanate, propan 2 ol 2 propanol isopropyl alcohol, propyl gallate, pvc poly vinyl chloride, radialimmunodiffusion teaching kit, salicylic acid, seleniumdioxide, silver sulfate, sodium acetate trihydrate, sodiumazide, sodium bicarbonate, sodium chloride, sodiumcitrate, sodium dithionite, sodium floride, sodiumhydroxide pellets, sodium hypochlorite, sodiummetabisulphite, sodium molybdate dihydrate, sodiumnitropruside, sodium phytate phytic acid sodium salthydrate, sodium propionate, sodium silico fluoride, sodium sulphate anhydrous, sodium thiosulphate, sodiumtri poly phosphate stpp, soyabean casein digest mediumtryptone soya broth, standard solution of seawater, starchagar, starch soluble, sulfanilamide, sulfosalicyclic acid, syringe filter 0 45 micrometer, tannic acid, tca trichloroacetic acid, tetracycline, thiamine hydrochloride, totalhardness kit, trichloro acetic acid, tricine, triethylamine, tris glycine sds gel running buffer 10x, tris saturatedphenol, tris free base, trizol, ttb, tween 80, vanillinreagent, yeast extract powder, zinc chloride dry, zincsulfate monohydrate

Central Government/Public Sector

TRN :35530878 | 24 Oct, 2025

Tender Value : 0

Bangalore - Karnataka

Tender for gem bids for books, 38th icaf conference and 31st icaf symposium icaf2023 international committee on aeronauticalfatigue and structural integrity conference 38th2023 and 31st symposium 2 vols 63rd israel annualconference on aerospace sciences 2024 aerodynamics for engineers aerodynamics oftandem wing aircraft from dinosaurs to uavs andsupersonic planes aerodynamics principles for airtransport pilots ai cybersecurity and datascience for drone and unmanned aerial vehiclesreal life applications and case studies aircraftdesign aircraft design a systems engineeringapproach 2nd edition aircraft manual india vol 12025 aircraft manual india volume ii 2023 aircraftpropulsion toward net zero aviation 4th edition cognitive electronic warfare an artificialintelligence approach computationalaerodynamics design principles of autonomoussystems uav ugv and auv engineering uasapplications sensor fusion machine vision andmission management ew 105 space electronicwarfare flight theory and aerodynamics apractical guide for operational safety introduction to aeroelasticity introduction toaircraft flight mechanics introduction toavionics systems introduction to labview fpga forrf radar and electronic warfare applications janes all the world aircraft unmanned 2025 26 janes all the worlds aircraft development andproduction 2025 26 janes all the worlds aircraftin service 2025 26 janes weapons air launched 20252026 materials and processes used in aircraftconstruction self protection jammer systems bid number gem2025b6748672 dated 03-10-2025 bid document1 74 1 1 standard methods for aerospace stress analysis, the secret horse power race western frontfighter engine development, wing theoryincompressible fluids, a hands on guide todesigning embedded systems, a mathematicalintroduction to control theory series inelectrical and computer engineering volume 8, advanced antenna technologies for aerialplatforms from design to deployment, applied ecmvol 1 and 2 1980 1985, distributed intelligentcircuits and systems world scientific series onfuture computing paradigms and applicationsvolume 3, effective application of softwarefailure modes effects analysis and software fmeatoolkit bundle 2nd edition, emergent behavior insystem of systems engineering real worldapplications, fundamentals of geometricdimensioning and tolerancing, internet of things ahardware development perspective, mechanicaltolerance stackup and analysis, multidisciplinarydesign optimization of complex structures underuncertainty, nonelectronic parts reliability datanprd 2023 five volume hard copy set plus a cd romsections 1 and 2 of the hard copy, principles andtechniques of electromagnetic compatibility, sensors and the internet of things acquisition anduse of big data, training and simulation processeschallenges and solutions, ai driven iot systemsfor industry 4, laser shock peening fundamentalsand advances, recent trends and best practices inindustry 4, smart manufacturing technologies forindustry 4 integration benefits and operationalactivities, composites modeling and manufacturing, fatigue of materials and structures physics anddata science, fracture mechanics and fatiguedamage of materials and structures, metalfatigue testing and analysis theory and practice, metallic materials properties development andstandardization mmpds handbook 2025 volume i andii, modeling damage fatigue and failure ofcomposite materials, smart materials for scienceand engineering, advances in applications ofcomputational intelligence and the internet ofthings cryptography and network security in iot s, artificial intelligence and machine learning acomprehensive guide, empowering artificialintelligence through machine learning newadvances and applications, legal aspects ofpurchasing and supply chain management, practical guide to drafting commercial contracts, taxmann s guide to commercial contractsmanagement, harrison s principles of internalmedicine vol 1 and vol 2, focus on what matters acollection of stoic letters on living well, healyour gut mind and emotions 5 steps to reset yourhealth with ayurveda and food chemistry, thecreative act a way of being, transform your selftalk the art of talking to yourself for confidencebelief and calm i rewire negative thoughts andbuild confidence, edeya hanate heart lamp bookerprize winning short stories kannada edition, omnamo kannada edition, reshme batte novel kannadaedition, runa kannada edition, three thousandstitches ordinary people extraordinary lives, //bid details2 / 74 uttarakaanda kannada edition, yaana novelkannada edition, a na kru avara samagra kathasankalana kannada edition, samasta nataka hsvkannada edition, kailasam kannada natakagalukannada edition, baduku badalisabahudu part 1kannada edition, santasa nannedeya haadu hakkibaduku badalisabahudu part 4 kannada edition, saave baruvudiddare naale baa badukubadalisabahudu part 2 kannada edition, solembudualpaviraama baduku badalisabahudu part 3 kannadaedition, aerospace mechatronics and controltechnology selected contributions from 2021 7thasia conference on mechanical engineering andaerospace engineering conference proceedings, aircraft electricity and electronics, designingaircraft simulators, basic radar analysis secondedition, let us c plus plus, prince2 7 made simple, aircraft anatomy a technical guide to militaryaircraft from world war ii to the modern dayencyclopedias, geometric dimensioning andtolerancing applications analysis gauging andmeasurement per asme y14 5 2018, aircraft design aconceptual approach, guide to projectmanagement body of knowledge pmbok guide andstandard for project management english, pmpexam prep 2023, speech and language processing anintroduction to natural language processingcomputational linguistics and speech recognition, foundations of statistical natural languageprocessing, introduction to information retrieval, dive into deep learning, big data and analytics, big data analytics, bayesian optimization and datascience, machine learning for materials discovernumerical recipes and practical applications, aircraft reliability and reliability centredmaintenance a practical guide for aircraftreliability engineers 1 airworthiness, s1000d brdpreference book for issues 1 point 9 through 6business rule decision points mapped in groups foreleven issues of the specification, managing yourfirst s1000d project a guide for technicalpublications project managers, prognostics andhealth management a practical approach toimproving system reliability using conditionedbased data, reliability prediction formicroelectronics, introduction to extendedreality xr technologies, talent wins the newplaybook for putting people first, the extendedmind the power of thinking outside the brain, thewake up closing the gap between good intentionsand real change, the moment of lift howempowering women changes the world, aur safalbane zindagi jeena seekhen bajaye zindagi kaatne kehindi edition, power thinking hindi edition, jeevanke adbhut rahasya jeewan mein kaise payensantulan aur uddeshya hindi edition, aseem anandki aur hindi edn of happiness unlimited hindi edition, ram ki shakti pooja evam anya kavitayein hindiedition, aapka bunti hindi edition, banaras talkieshindi edition, mrityunjaya a novel based on the lifeof karna hindi edition, hindi saahitya ka itihaashindi edition, sabse mushkil kaam sabse pahle hindiedition of eat that frog hindi edition, tithuratahua gantantra hindi edition, laute hue musafirhindi edition, gopi ki diary hindi edition

Related Searched Keywords : cd case

List of cd-case Tenders

Get cd case Tender Alert...

Related Searched Keywords : cd case

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us