Filters

List of calpol-syrup Tenders

List of latest calpol-syrup Tenders in Indian Tenders. Click on any calpol-syrup Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for calpol-syrup Tenders.

All-Tenders (4)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35709548 | 14 Nov, 2025

Tender Value : 0

Ferozepur - Punjab

Tender for gem bids for procurement, bid number gem2025b6819796 dated 24-10-2025 bid document1 85 1 1 tab ibugesic asp, tab flexon, tab calpol 500 plus, tabflexon mr, dolostat pc 100 mg plus 325 mg tablet, tablevisiz m, levosiz-m kid tablet, tab avil 25, moxikind-cv375 tablet, moxikind-cv 625 tablet, azicip 500 tablet, azicip 250 tablet, tab sinarest new, tab amaryl 2 mg, cap omez 20, cap pantop dsr, tab gabapin nt 400, capvizylac, gasowel effervescent tablet, tab nusam 400, pregabanyl-m 75 sr tablet, tab lipikind 20, tab stator f10, cap becosules- z, tab supradyn, tab neurobion plus, tab neurobion forte, oint volini gel 12 gm, volini maxxpain relief spray 25 gm, susp pantop mps sugar free 200ml, inj aciloc 2ml, liq mucaine gel mint sugar free 200 ml, susp sucral o, t-bact 2 percent ointment 5 gm, febrinil150mg injection 3 ml, paracip infusion 100 ml, inj drotin 2ml, cyclopam 10mg injection, biscotas 20mg injection, ascoril plus expectorant ginger lemon, inj dopamine, injdextrose 10 percent, inj rl 500 ml, inj dns 500 ml, foracort 200 rotacap - 30 rotacap, duolin rotacap - 60rotacap, otrivin oxy fast relief adult nasal spray, alkacipsyrup 100ml, mouth wash hexidine 80 ml, psyllium husk100 gm, cyclopam suspension 30 ml, syp alerid 30 ml, new o2 oral suspension, syp ondem 30 ml, liquidazithral 200, clavam dry syrup, calpol 250mg paediatricoral suspension, syp becosules 120 ml, calpol paediatricdrops peppermint, ibufyl plus oral suspension, rantopsyrup, montina-l syrup, filter paper round for laboratoryuse 100 nos packing, tissue paper, dettol liquid handwash 5 ltr, distilled water 5 ltr, erba glucose kit 2x200ml, erba h-360 pinter paper roll cbc analyzer 55 mm, widal kit - beacon - 4x5 ml, micro tips 100-1000 ul, plastictest tube rack 100 holes, erba urea kit 5x20 ml, erbacholesterol 5x20 ml, erba hdl 2x50 ml, erbatriglyceride 5x20 ml, micro tips 10- 100ul, sodium citratesolution 3.8 percent 250 ml, uristix urine strips 2parameter, j. mitra blood group test kit 3x10 ml, clotactivator test tube, roche trop t sensitive test strips, k3edta vial, erba s. bilirubin total and direct kit 4x60 ml, erba sgpt kit 5x20 ml, erba sgot kit 5x20 ml, erbaalkaline phosphate kit 4x24 ml, erba albumin kit 5x50 ml, erba total protein 5x50 ml, erba s. creatinine 4x60 ml, erba uric acid kit 5x20 ml, methanol 500 ml, edtasolution 5 percent 125 ml, glucostrip accuchek active, hivtest kits - sd biosensor standard q hiv 1and 2 ab rapidcard - pack of 30 tests, hbsag test kits - sd biosensorstandard q hbsag rapid card - pack of 30 tests, dengurapid kit ns1, igg, igm, urine pregnancy test kit, typhoiddt rapid kit igg igm, sodium hypo choloride 5 percent 5ltr, erba wash 4x50 ml, esr vacutainner glass black, esr dispo plastic piptte, erba elite h clean 4x50 ml, sdmalaria card, dispovan syringe 5 cc, dispovan syringe 3cc, ecg jelly 250 ml, ecg paper bpl cardiat 9108 - 100sheet per roll, surgical gloves 7.5 no., medigrip adhesivespot bandage - 25mm round paper box, stitch silk nylon, surgical spirit 100 ml, stitch needle curved various size, roller bandage 7.5 cm, hand sanitizer 500 ml, surgicalspirit 400 ml, spirit swab, clinical thermometer, accucheck lancet, lox 10percent spray 50 ml //bid details2 / 85

Central Government/Public Sector

TRN :35713251 | 15 Nov, 2025

Tender Value : 0

East Khasi Hills - Meghalaya

Tender for gem bids for cholesterol fsr 4x25 ml, triglyceride fsr 4x25 ml, glucosefsr 5x100 ml, urea fsr 4x20 ml 4x5 ml, creatinine fsr2x25ml 2x25ml, direct bilirubin fsr 4x25ml, total bilirubinfsr 4x25ml, sgpt fsr 4x20ml 4x5ml, sgot fsr 4x20ml4x5ml, hdl cholesterol fsr 4x25 ml, total protein fsr014x50ml, albumin fsr01 4x50ml, accu chek active glucosetest strip, urinalysis reagent strips, trop t test kit, typhoid iggigm rapid test kit, hbsag rapid test kit, crp test kit, rf rarheumatoid factor rheumatoid arthritis test kit, prega newsupt kit, anti-snake venom, rabies vaccine xprab vaccine, test tube 5 ml, thomas splint, thumb spica splint, kneeimmobilizer splint 19 inch, universal shoulder immobilizer, wrist and forearm splint, forearm splint, pelvic splint, tabavil, tab digene, tab calpol 650, tab levocetrizen 5, augumentin duo syrup, tab sorbitrate, tab amlokind 5, capunienzyme, respules asthalin, respules duoline 3, tabdericip retard 150, tab lopramide, injection ondem, electoralpowder, larinate 200 kit tablet, lipikind 20 tablet, asthalin 4tablet, acimol 100mg 325mg tablet, montina l tablet, aciloc150 tablet, eye drop ciplox d, eye drop eyelet, calpol 250 mgsyrup, pcm 100 mg drop, injection mvi, naselin saline spray, micropipette tips 5, iv set, paper tap, gauze than, ecg gelly /bid number: gem/2025/b/6822214* /dated: 25-10-2025 & & / bid document1 / 54

Central Government/Public Sector

TRN :35692311 | 10 Nov, 2025

Tender Value : 50.0 Thousand

Taran Taran - Punjab

Tender for gem bids for drugs, syrup ascoril d plus 100 ml, susppension calpol 250 mg 5ml, syrup dexorange 200 ml, tablet limcee 500 mg, tablet fluca 150 mg, tablet telma 40 mg, tabletneurobion forte, tablet dolo 650 mg, tablet gluconormsr 500 mg, liquid digene 200 ml, capsule omesec 20 mg, capsule becosules, refresh eye drop 10 ml, omnigel 20gm, cream candid 30 gm, candid powder 60 gm

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Related Searched Keywords : calpol syrup

List of calpol-syrup Tenders

Get calpol syrup Tender Alert...

Related Searched Keywords : calpol syrup

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us