Filters

List of antioxidant Tenders

List of latest antioxidant Tenders in Indian Tenders. Click on any antioxidant Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for antioxidant Tenders.

All-Tenders (62)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35667068 | 27 Oct, 2025

Tender Value : 19.74 Lacs

Pithoragarah - Uttaranchal

Tender for 58 1 1 tab tenofovir 25 mg, tab alpha ketoanalouge 667mg, tabdaflon 500mg, tab montelukast 10mg, resp.salbutamol, tab antioxidant with lycopene, tab mebeverinehydrochloride 135mg, tab levodopa 200mg pluscarbidopa 50mg syndopa 250, e d nepafenac 5 ml, sypcyproheptadine 200ml, tab lopinavir 200mg plus ritonavir50mg, tab brivaracetam 100 mg, tab sulfasalazine500mg, tab rabeprazole plus domperidone, tabvildagliptin 50mg, tab isosorbide dinitrate 20mg plushydralazine 37.5mg isolazine 50mg, tab dutasteride 0.5mg, syp liver tonic liv 52 100ml, tab mesalamine 1.2gm, tab piracetam 800mg, ed brinzolamide 1 per plusbrimonidine 0.2 per, tab duloxetine 20mg, tabthiocolchicoside 4mg, tab paracetamol plus diclofenacplus chlorzoxazone cipzox, lumber belt size small, bravapaste colostomy 12050, mdi levosalbutamol plusbaclomethasone, cap simethicone 80mg plus activatedcharcoal, tab mirabegron 25 mg, tab glucosamine pluschondrotin, syp digestive enzyme 200ml, syp iron 200ml, tab acebrophylline 100mg, barrier cream colostomy 4720, glutamine sachet, tab eplerenone 25mg, isabgol husk3.5gm, tab vericiguat 10 mg, gluco one sugar strips packof 50 strips dr.morpen, lumber belt size medium, lumberbelt size-large, tab tramadol 50mg, respulesglycopyrrolate 25mcg solution, tab pantoprazole plusdomperidone, capd fluid 2.5 per pd-4 low calcium with2.5 per dextrose, mdi tiotropium bromide, film x ray15x12 green base, tab gliclazide 80mg, tab trypsin pluschymotrypsin chymorol forte, tab rosuvastatin 10mg, tabcilnidipine 10mg, tab cilostazole 100mg, tabpentoxyphylline 400 mg, tab nortriyptyline 25mg, tab sadenosyl lmethionine 200 mg, tab finasteride 5mg, ointbetamethasone plus gentamycin, povidine iodine solution100ml, tab antacid, sachet oral rehydration salt ors5gm, tab zidovudine 300mg, tab tolterodine 2mg, tabisorbide mononitrate 30mg, tab sevelamer 400mg, tabprazocin 2.5mg, tab pancreatin 170mg plus dimethicone80mg pankreoflat, tab tenofovir 300mg, tab bicalutamide50mg, tab solifenacin 5mg, syp disodium hydrogencitrate 100 ml, tab sodium valporate plus valporic acid500mg, tab rosuvastatin 20mg, ketoconazole shampoo100 ml, desensitising paste stannous fluoride potassiumnitrate sod monofluro phosphate tube of 50 gm, capomega 3 fattyacid minerals, insulin soluble humanregular, tab trimetazedine 35 mg mr, tab sevelamer800mg, tab flupirtine 100mg, tab olmisartan 40mg, capcoenzyme q10 lycopene l carnitine tartrate omega 3 fattyacid vitamins, tab isosorbide mononitrate 20mg, tabdoxepine 75mg, r c glycopyrinium 50mcg, tabfexofenadin 120mg, tab divalprox sodium cr.500mg, tabcommon cold anti cold, tab ranolozine 500mg, tabnitroglycerine 2.6mg, chlorhexidine mouth wash 100ml, tab rifaximin 400mg, tab lacosamide 100mg, nasalspray fluticasone 10 ml, tab vitamin b complex, tablosartan 50 mg

Central Government/Public Sector

TRN :35644013 | 27 Oct, 2025

Tender Value : 0

Udaipur - Rajasthan

Tender for gem bids for acarbose 50 mg tab, acotiamide 100mg tab, cilostazole100 mg tab, cilnidipine 10 mg with telma 40 mg tab, acetylcysteine 300mg with pyridoxamine dihydrchloride50mg tab, carbamazepine 200 mg tab, alcoholic handsanitizer bott of 500 ml, glutaraldehyde solution 2.45perwv 5 ltr cidex activated gta solution, methylcobalamin1500mcg with alpha lipoic acid 100mg with myo inositol100mg with folic acid 1.5mg with chromium picolinate200mcg with selenium 55mcg with benfotiamine 150mg, mebeverine 135 mg tab, loperamide 2mg tab, omegafatty acid with antioxidant cap, ondansetron 4mg tab, deflazacort 6mg tab, desloratadine 5mg tab, dexamethasone 0.5 mg tab, diosmin 450mg withhesperidin 50mg tab, dosulepin 25mg tab, fexofenadine120mg with montelukast 10mg tab, hydrogen peroxidesolution bottle of 500 ml, tab torsemide 5mg, tabvercigut 10mg, palonix tab 300 mg, inj erythropoetin 50 iu, disopyramide 100 mg cap, hif plus tab, tab oleptal900mg, tab safinamide 50 mg, tab rivastigmine 3 mg, injtirzepatide 5mg, tab sodium valproate 300mg, tablobeglutazone 0.5mg, tab mirtazepine 7.5 mg, tabmidodrine 2.5mg, tab carbamazepine 100mg, aspirin 75mg and atorvastatin 10 mg tab, asthalin rotacap pack of30 cap, oint hydroquinone 2per and tertinoin 0.025per andmometasone 0.1per, ketorolac 10 mg tab, novo penneedles, rifaximine 400 mg tab, zolpidem 10 mg tab, antispasmodic contaning mefenamic acid 250 mg anddicylcomine hcl 10 mg tab, inj insulin aspart 100 iuml, aceclofenac 100 mg and drotaverine 80 mg tab, glimepiride 2 mg and metformin 1000 mg tab, leviteracetam 250 mg tab, macvestin 500 mg tab, injtirzepatide 2.5mg, primidone 25 mg tab, luliconazoleointment, inj methylcobalamine 500 mcg, paroxetine 12.5mg and clonazepam 0.5 mg tab, trypsin and chymotrypsinand diclofenac tab, fusidic cream, liquid disodiumhydrogen citrate 100 ml, syrup iron and vit b12 and folicacid 200ml, silver sulphadiazene oint, sodium bicarbonate1000mg tab, sodium valproate 500mg tab, sumatriptan50mg tab, syp ibugesic bott of 100 ml, tacrolimus 2mgtab, teneligliptin 20 with metformin 500mg tab, torsemide100mg tab, torsemide 40mg tab, trifluoperazine 5mg withtrihexyphenidyl 2mg tab, zolpidem 5mg tab, rotahaler forrotacaps, eye drop fluromethlolone, montelukast10 withbilastin 20mg tab

Central Government/Public Sector

TRN :35644207 | 27 Oct, 2025

Tender Value : 5.36 Lacs

Sagar - Madhya Pradesh

Tender for gem bids for drug, levodopa 100mg and carbidopa 10mg tab levodopa100mg and carbidopa 25mg and entacapone 200mgsyncapone tab levodopa 200 mg and carbidopa 50mg cr tab levoflox 500 mg tab levosalbutamol100mcg and beclometasone 100mcg rotacapaerocort levosalbutamol 100mcg and ipratropium40mcg rotacap levosalbutamol 125mg andipratropium 500mcg respule levosalbutamol50mcg and beclometasone 50mcg inhaler linagliptin 5 mg tab lorazepam 1 mg tab luliconazole cream lumber belt extra large lumber belt large lumber belt medium mecovit500mg tab medroxy progestrone 10mg tab mesalamine 12 gm tab methotrexate 25 mg tab methylcobalamin 1500 mg tab methylcobalamin500mg tab methylprednisolone 4mg tab methylprednisolone 8 mg tab metoprolol sr 50 mgtab metoprolol xl 25 mg tab metronidazole 400mg tab metronidazoleandchlorhexidineandlignocain oral gel micronised flavonoid 500mgtab daflon minoxidil 5per w v lotion 60 ml mirtazapine 75 mg tab mometasone 01per tube of10 gm oint montelukast 5 mg tab multivitamin andmultimineral tab multivitamin syp mupirocin 2peroint 5 gm mycophenolate 500 mg tab naproxen250 mg tab neomycin and beclometahsone andclotrimazole e d ear drops neomycin and polymixinand bacitracin neosporin oint neomycin andpolymixin and bacitracin neosporin powder neurobion forte tab nicorandil 10mg tab nitrofurantoin 100 mg cap nitroglycerin 26mgtab nitroglycerin 64mg tab non sterile glovesmedium norfloxacin 400mg and tinidazole 600mg bid number gem2025b6752531 dated 16-10-2025 bid document1 113 1 1 tab, nortriptyline 10 mg tab, novelon tab ethinylestradiol 0.03mg and desogestrel 0.15mg, ointclobetasole 0.05per and salicylic acid 3.5perandpropylene glycol oint tube of 20gm, ointmiconazole, olanzapine 10 mg tab, olanzapine 2.5mg tab, olopatadine 0.1per bottle of 5 ml e d, omega fatty acid and antioxidant cap, omeprazole20 mg cap, oxcarbazepine 300mg tab, pantaprozole40 mg and domperidone 10 mg pan d, pantoprazole20 mg tab, pantoprazole 40 mg and domperidone sr30 mg cap, pantoprazole 40 mg and levosulpiride 75mg cap, paradichlorobenzene ear drop clear wax, pcm 250 mg and caffein 100 mg andergotamine1mgandprochlorperazine 2.5 vasograin tab, phenytoin sodium 100 mg eptoin, polyethelenglycol and propylene glycol systane e d, pomalidomide 2 mg tab, povidone iodine 10 per oint, povidone iodine sol 10per bottle of 100 ml, pramipexole 0.125 mg tab, pramipexole 0.25mg tab, prasugrel 10 mg tab, prednisolone 10mg tab, prednisolone 5 mg tab, pregabalin 75 mg andnortriptyline 10 mg and methylcobalamin 1500 mcgtab, pregabalin 75 mg and ntp 10 mg tab, pregabalin75mg and methylcobalamin 750 mg tab, pregablin 75mg, rabeprazole 20 mg tab, rabeprazole 20 mgandlevosulpride 75mg tab, rabeprazole 20mg anditopride 150mg tab, rabeprazole 20mganddomeperidon 10mg tab, ramipril 10 mg tab, ramipril 2.5mg tab, ramipril 5 mg tab, repaglinide1mg tab, respule levosalbutamole 1.25 mg, risperidone 1 mg tab, risperidone 2 mg tab, rollerbandage 10 cm, roller bandage 15 cm, rosuvastatin 10 mg tab, rotacap salmeterol 50mcg and fluticasone 250 mcg, sacubitril 24mg andvalsartan 26mg tab, salmeterol 50mcg andfluticasone propionate 250mcg, sertraline 50 mgtab, silodosin 8 mg and dutasteroide 0.5 mg tab, sitagliptin 100 mg tab, sitagliptin 50 mg tab, sitagliptin 50mg tab and metformin 500mg tab, sodium bicarbonate 1000 mg tab, sodium chloride0.65per nasal drops nosoclear, sofosbuvir 400mgand velpatasvir 100mg cap, solifenacin 5 mg tabsoliten, spironolactone 25mg tab, spironolactone50 mgaldectone, sucralfate 1gm 5ml bott of 200 ml, sulfasalazine 500 mg tab, sumatriptan 50 mg tab, syp alpha - amylase pepsin digestive enzyme, sypantacid gel 170 ml digene gel, syp augmentin amoxy200andclavulanic acid 28.5, syp azithromycin 200 mg5ml, syp cough expectorant 100 ml, syp iron andfolic acid, syp lactulose 100 ml bott, sypmetronidazole 60 ml, tacrolimus 0.3per oint, tamsulin 0.4 mg and dutasteride 5 mg tab urimax dtab, telmisartan 40 mg tab, telmisartan 80 mg tab, telmisartan h 40 mg and 12.5 mg tab, tendocare tab, thiamine 100mg tab, thyroxin 100 mcg tab, thyroxin 12.5mcg, thyroxine 25 mcg tab, thyroxine50 mcg tab, thyroxine 75 mcg tab, ticagrelor 90mgtab brilinta, tofacitinib 5 mg tab, tolperisone sr150 mg, tolterodine 2 mg tab, torsemide 10andspironolactone 50mg tab, torsemide 10 mg tab, torsemide 20 mg tab, tranexamic acid 500 mg andmefenamic 250 mg tab, triamcinolone 0.1per oralpaste, trihexyphenidyl 2mg tab, trimetazidine mr35 mg flavedon mr tab, trypsin and chymotrypsin 6 //bid details2 / 113 100000 au enteric coated chymoral fort tab, ursodexycholic acid 300mg tab udiliv, vericiguat2.5 mg tab, vildagliptin 50mg tab, vitamin e evion200mg cap, voglibose 0.2mg tab, voglibose 0.3mgtab, xylometazoline 10 ml nasal drop, novopenneedle all size, prucalapride 2 mg tab, tabrelugolix 120 mg degarelix, tab prazosin 5 mg, insulin highly purified human neutral 40iu ml 10 mlinj regular, anastrazole 1 mg tab, acarbose 50 mgtab, antacid chewable digene tab, antihaemorrhoidal cream with beclomethasonedipropionate anovate oint, aspirin 150 mg tab, clopidogrel 75 mg tab, dapagliflozin 10 mg tab, dapaglifozin 5 mg tab, ed carboxy methylcellulose 0.5 per bott of 5ml, etoricoxcib 90mg tab, inj glargine 100iuml 3ml pen, insulin aspart 30 perand insulin aspart protamine 70 per 100iuml injectionnovomix 30 flexpenlevodopa 100mg and carbidopa 10mg tab, levodopa100mg and carbidopa 25mg and entacapone 200mgsyncapone tab, levodopa 200 mg and carbidopa 50mg cr tab, levoflox 500 mg tab, levosalbutamol100mcg and beclometasone 100mcg rotacapaerocort, levosalbutamol 100mcg and ipratropium40mcg rotacap, levosalbutamol 1.25mg andipratropium 500mcg respule, levosalbutamol 50mcgand beclometasone 50mcg inhaler, linagliptin 5 mgtab, lorazepam 1 mg tab, luliconazole cream, lumber belt extra large, lumber belt large, lumberbelt medium, mecovit 500mg tab, medroxyprogestrone 10mg tab, mesalamine 1.2 gm tab, methotrexate 2.5 mg tab, methylcobalamin 1500 mgtab, methylcobalamin 500mg tab, methylprednisolone 4mg tab, methylprednisolone 8mg tab, metoprolol sr 50 mg tab, metoprolol xl 25mg tab, metronidazole 400 mg tab, metronidazoleandchlorhexidine andlignocain oralgel, micronised flavonoid 500mg tab daflon, minoxidil 5per w v lotion 60 ml, mirtazapine 7.5 mgtab, mometasone 0.1per tube of 10 gm oint, montelukast 5 mg tab, multivitamin andmultimineral tab, multivitamin syp, mupirocin 2peroint 5 gm, mycophenolate 500 mg tab, naproxen 250mg tab, neomycin and beclometahsone andclotrimazole e d ear drops, neomycin and polymixinand bacitracin neosporin oint, neomycin andpolymixin and bacitracin neosporin powder, neurobion forte tab, nicorandil 10mg tab, nitrofurantoin 100 mg cap, nitroglycerin 2.6mg tab, nitroglycerin 6.4mg tab, non sterile gloves medium, norfloxacin 400mg and tinidazole 600mg tab, nortriptyline 10 mg tab, novelon tab ethinylestradiol 0.03mg and desogestrel 0.15mg, ointclobetasole 0.05p salicylic acid 3.5p propyleneglycol of 20gm, oint miconazole, olanzapine 10 mgtab, olanzapine 2.5 mg tab, olopatadine 0.1perbottle of 5 ml e d, omega fatty acid and antioxidantcap, omeprazole 20 mg cap, oxcarbazepine 300mgtab, pantaprozole 40 mg and domperidone 10 mg pand, pantoprazole 20 mg tab, pantoprazole 40 mg anddomperidone sr 30 mg cap, pantoprazole 40 mg andlevosulpiride 75 mg cap, paradichlorobenzene eardrop clear wax, pcm 250 mg caffein 100 mgergotamine 1mg prochlorperazine 2.5 tab, phenytoin sodium 100 mg eptoin, polyethelen glycol

Central Government/Public Sector

TRN :35629368 | 24 Oct, 2025

Tender Value : 0

Varanasi - Uttar Pradesh

Tender for gem bids for aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , levosalbutamol respules , salbutamol 200 mcg rotacap , atenolol 50mg plus amlodipine 5 mg tab , atomoxetine 10 mg tab , atorvastatin 40 mg tab , atorvastatin 80 mg tab , azathioprine 50 mg tab , azelastine 140 mcg plus fluticasone 27.5 mcg nasal spray , azelastine 140 mcg plus fluticasone 50 mcg nasal spray , azelnidipine 8 mg tab , azilasartan 40 mg tab , baclofen 10 mg tab , band aid misc , bandage 10 cm x 4 meters misc , bandage 2.5 cm x 4 metres misc , bandage 6 cm x 4 metres misc , beclomethasone dipropionate 50 mcg plus levosalbutamol 50 mcg inhaler , benidipine hydrochloride 8 mg tab , benidipine hydrochloride 4 mg tab , oint benzoyl peroxide 2.5 percent w by w , povidone iodine gargles misc , oint povidone iodine usp 10 per w by w , betahistine 16 mg tab , betahistine 8 mg tab , betahistine 24 mg tab , oint betamethasone 0.05 per plus salicylic acid 3 per , oint betamethasone 0.1 per plus neomycin 0.5 per , oint betamethasone plus gentamycin , betamethasone 4 mg injection , oint betamethasone plus neomycin plus clotrimazole cream , bethanechol 25 mg tab , bilastine 20 mg dispersible tab , bimatoprost 0.03 per w by v eye drops , biotin 10 mg tab , biotin 10mg, iron 8mg l cysteine 5mg manganese 5mg copper selenium l lysine 20mg zinc 25mg dimethionine 40mg calcium pantothenate 50mg niacinamide50mg tab , biphasic isophane insulin 50 human insulin 50 percrent as soluble insuline plus 50 percent isophan insulin suspension 100iu per ml mixtard 50 3ml cart injection , bisacodyl 5 mg tab , bisacodyl 10 mg tab , bisoprolol 2.5mg tab , bisoprolol 5mg tab , bosentan 62.5 mg tab , brimonidine 0.2 percent w by v eye drops , brimonidine 0.15 percent plus timolol 0.5 percent eye drops , brimonidine 0.2 percent plus timolol 0.5 percent eye drops , brivaracetam 100mg tab , brivaracetam 50mg tab , bromelain 180 mg plus trypsin 96 mg plus rutoside 200 mg , bromhexine 2mg plus guaifenesin 50mg plus menthol 1mg plus terbutaline 1.25mg syp , bromhexine 100 ml syp , sodium hyaluronate 1 mg per ml preservative free phosphate free with comod system eye drop , travoprost 0.004 percent w by v eye drop , efavirenz 600 mg tab , elastic knee support misc , elastic knee support large misc , elastoplast misc , elbow support misc , enalapril 10mg tab , enalapril 2.5 mg tab , enalapril 5 mg tab , entecavir 0.5 mg tab , eplerenone 25 mg tab , escitalopram 10 mg plus clonazepam 0.5 mg tab , escitalopram 20mg tab , escitalopram 5 mg tab , esr disposable piptte misc , esmoprazole 20 mg tab , esomeprazole 20 mg plus domperidone 30 mg tab , esomeprazole 40 mg tab , ethinyl estradiol 0.03mg plus drospirenone 3 mg kit of 21 tab , etizolam 0.5mg tab , etoricoxcib 120mg tab , etoricoxib 60 mg tab , evening promise 1000 cap , everolimus 0.5 mg tab , tobramycin0.3 percent 5 ml eye drop , gentamycin plus hydrocortisone eye drops , ciprofloxacin 0.3 percent eye oint , ezetimibe 10 mg tab , faropenem sodium 200 mg tab , febuxostat 80 mg tab , fenofibrate 145 mg tab , fenofibrate 160mg tab , fenofibrate 200 mg tab , fexofenadine 120 mg plus montelukast 10mg tab , fexofenadine 120mg tab , finasteride 5 mg tab , flavoxate 200mg tab , fluconazole 200 mg tab , flunarizine 10 mg tab , fluocinolone 0.1 percent w by v shampoo lotion , fluoxetine 10 mg cap , fluoxetine 20mg tab , flupiritine maleate 100 mg tab , flurbiprofen 0.03 percent w by v eye drop , fluticasone furoate 27.5 mcg nasal spray , oint fluticasone propionate 0.005 percent , fluticasone propionate 50 mcg bp nasal spray , fluvoxamine 50mg tab , foleys catheter 2 way size 16 fr misc , nifedipine retard 20 mg tab , nitrofurantoin 100 mg cap , nitroglycerin 6.4 mg tab , norethisterone 5mg tab , normal saline bott of 500 ml , nortriptyline 10 mg tab , oint ofloxacin plus orninizole plus itraconazole plus clobetasol cream , oint clobetasol plus salicylic acid , oint acyclovir 5 percent w by w skin cream , oint miconazole nitrate 2.0 percent w by w , olanzapine 10 mg tab , olanzapine 5 mg tab , olmesartan 20 mg tab , olmesartan 40 mg tab , olopatadine 0.2 percent ophthalmic soln bott of 5 ml eye drop , omega 3 fatty acid 500 mg cap , omega fatty acid plus antioxidant cap , ondansetron 4 mg tab , ondansetron 8 mg tab , ondansetron 2 mg per 5ml in bott of 30 ml syp , orciprenaline 10mg tab , ortho arthritis knee brace misc , oxybutynin 2.5 mg tab , pancreatin 10000 iu tab , pancreatine minimicrosphere with lipase 25000 cap , pantaprozole 40 mg plus domperidone 10 mg cap , pantoprazole 40mg plus itopride 150mg cap , pantoprazole 40 mg plus domperidone sr 30 mg cap , pantoprazole 40 mg plus levosulpiride 75 mg cap , paracetamol 1000 mg tab , paracetamol 125mg per 5ml syp , paradichlorobenzene 2 percent w by v plus benzocaine 2.7 percent w by v plus chorbutol 5 percent plus turpentine oil 15 percent w by v ear drop , paroxetin 25 mg tab , paroxetine 12.5mg tab , paracetamol 250 mg plus caffein 100 mg plus ergotamine 1mg plus prochlorperazine 2.5 tab , pentoxifylline 400 mg tab , perindoepril 4 mg plus indapamide 1.5 mg tab , perindopril 4 mg tab , perindopril 8 mg tab , oint permethrin 5 percent w by w tube of 30 gm , permethrin 5 percent w by v lotion , pheniramine maleat 25mg tab , phenobarbitone 30 mg tab , phenytoin sodium 100 mg tab , pioglitazone 15 mg tab , pioglitazone 30mg tab , piracetam 400 mg tab , piracetam 800 mg tab , piroxicam 20mg tab , pitavastatin 2 mg tab , torsemide 100 mg tab , torsemide 10 plus spironolactone 50 mg tab , torsemide 20 mg tab , torsemide 5 mg plus spironolactone 25 mg tab , tramadol 50 mg cap , tramadol plus dicyclomin plus acetaminophen tab , tranexamic acid 500 mg plus mefenamic 250 mg tab , tranexamic acid 500 mg tab , oint tretinoin 0.025 percent oint , oint tretinoin 0.05 percent oint , triamcinalone 40mg injection , oint triamcinolone acetonide 0.1 percent for oral use tube of 5 gm , trifluoperazine 5 mg tab , trihexyphenidyl 2mg tab , trimetazidine 20 mg tab , trimetazidine mr 35 mg tab , tropicamide 0.5 percent with 5 percent phenylephrine bott of 5 ml eye drop , tropicamide eye solution 1 percent bott of 5 ml eye drop , trypsin and chymotrypsin 6 is to 1 100000 au enteric coated tab , trypsin, chymotrypsin, diclofenac chymoral forte d tab , typhi dotkit of 50 test lab , ubidecarenone 300mg tab , ubiquinol acetate 100 mg tab , oint urea cream, urea 10 to 12 percent lactic acid 5 to 10 percent in pack of 50 gm , kits for estimation of urea lab , uric acid lab , urinary bag misc , uristick bott 100 strip lab , ursodeoxycholic acid 300 mg tab , valsartan 40 mg tab , venlafaxine 37.5mg tab , vericiguat 2.5 mg tab , vildagliptin 50mg tab , vit a d e c b1 b12 folic acid biotin menopace tab , vitamin a 50000 iu cap , oint volini gel tube of 50 gm linseed oil plus diclofenac plus methyl salicylate plus menthol gel , warfarin 5 mg tab , widal test kit lab , nasal decongestant adult drops xylometazoline hcl 0.1 percent w by v bottle of 10 ml nasal drop , xylometazoline 10 ml nasal drop , xylometazoline hydrochloride 0.1 percent nasel spray , ziprasidone 20 mg tab , zolpidem 10 mg tab , zolpidem 5 mg tab , zonisamide 50 mg tab , novopen needle all size misc , topiramate 25 mg tab , topiramate 50mg tab , oxetacaine aluminium hydroxide and magnesium hydroxide anesthetic antacid gel syp

Central Government/Public Sector

TRN :35608710 | 25 Oct, 2025

Tender Value : 37.99 Lacs

Jaipur - Rajasthan

Tender for gem bids for echs, omega fatty acid plus antioxidant cap, paracetamol500mg plus ibuprofen 400mg tab, propyl thiouracil 50mgtab, pyridoxine 40 mg tab, rabeprazole 40 mg tab, rasagaline 0point5 mg tab, rasagaline 1 mg tab, repaglinide 1mg tab, repaglinide 2 mg tab, respulelevosalbutamol 0point63mg in 2point5 ml, riluzole 50mgtab, risperidone prolonged release suspension, rivoraxaban 2point5 mg tab, rizatriptan 5 mg tab, ropinirole 0point5 mg tab, ropinirole 2 mg tab, safinamide 50 mg tab, savlon liquid, chlorhexidinesolution containing, secnidazole 1000 mg tab, sodiumhypochlorite solution 5percentage, can of 5 ltr, sodiumvalproate plus valproic acid acid 200 mg tab, sofosbuvir400 mg plus daclatasavir 60 mg tab, solifenacin 5 mg tab, spironolactone 50 mg, spray melatonin 1point5 mg spray, sulphacetamide 20percentage wpointv eye, sumitriptan50 mg tab, syp lactulose 10 gm 15 ml, bott of 200 ml, syp liver tonic liv 52, tab sodium valproate 500 mg crsodium, tadalafil 20 mg tab, tadalafil 5 mg tab, tapentadol 50 mg tab, terbinafine 1percentage cream, tube of 10 gm, tianeptine 12point5 mg tab, timololmaleate 0point05percentage eye drop, , trimetazidine 20mg tab, voglibose 0point3mg tab, zolpidem 5 mg tab /bid number: gem/2025/b/6735983* /dated: 11-10-2025 & & / bid document1 / 35

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

corporations/Associations/Others

TRN :35591307 | 31 Oct, 2025

Tender Value : 0

Visakhapatnam - Andhra Pradesh

Tender for gem bids for rate contract for antioxidant 2, 6 dbpc

Central Government/Public Sector

TRN :35530863 | 24 Oct, 2025

Tender Value : 0

East Khasi Hills - Meghalaya

Tender for gem bids for baclofen, baclofen 10mg tab, tab etoricoxib 90mg, naproxen250mg tab, tramadol hcl 50mg cap or tab, indomethacin75mg sr tab, amoxycillin 250mg cap, cremaffin whiteeach 15ml containing milk of magnesia 11 point 25ml andliq paraffin 3 point 75ml bott of 170ml, tab sodiumbicarbonate 500mg, probiotic lactobacillus sporogenes capmultibacillary 4 or more organism, mebeverin hcl 135mgtab, isabgol husk 3 point 5 gm, loperamide 2mg tab, tabitopride 50mg, tab phenytoin sodium 100mg, levetiracetam 500mg tab, oxcarbazepine 300mg tab, alprazolam 0 point 25 mg tab, levodopa 125mg withcarbidopa 25mg tab, tab lithium corbonate 300mg, pregabalin 75mg cap or tab, gabapentin 300mg cap, tabmethylcobalamine 1500mcg, trihexyphenidyl hcl 2mg tab, phenobarbitone 30mg tab, carbamazepine 200mg tab, soft gelatin antioxidant cap, chondoitin sulphate plusglucosamine plus diacerin tab, alendronate sodium 70mgtab, heamatinic tab or cap containing ferrous fumarate100mg elemental iron folic acid 500 to 1500mcg, n acetylcysteine 600mg tab, folic acid 5mg tab, tenofovir 300mgtab plus tab lamivudine 150mg plus tab efavirenz 600mg, tab tenofovir 300mg, montelukast 4mg plus levocetrizine2 point 5mg combination tab, tacrolimus 0 point 5mg tab

State Government

TRN :35661204 | 24 Oct, 2025

Tender Value : 16.43 Lacs

Mumbai - Maharashtra

Tender for repairs to plaster, wall tiles, polymer mortar, doors, windows, toilet block, kitchen otta, and repainting to flat no. 15 at bel heaven building

State Government

TRN :35661579 | 24 Oct, 2025

Tender Value : 11.43 Lacs

Mumbai - Maharashtra

Tender for repairs and renovation to kitchen trolley, kitchen storage, kitchen shutter, dado, plaster with polymer mortar and repainting to kitchen in flat no. 17 at bel heaven building

Related Searched Keywords : antioxidant

List of antioxidant Tenders

Tender for gem bids for rate contract for antioxidant 2, 6 dbpc

Tender for repairs to plaster, wall tiles, polymer mortar, doors, windows, toilet block, kitchen otta, and repainting to flat no. 15 at bel heaven building

Tender for repairs and renovation to kitchen trolley, kitchen storage, kitchen shutter, dado, plaster with polymer mortar and repainting to kitchen in flat no. 17 at bel heaven building

Get antioxidant Tender Alert...

Related Searched Keywords : antioxidant

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us