Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
Keyword Tenders
»
Antioxidant
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of antioxidant Tenders

List of latest antioxidant Tenders in Indian Tenders. Click on any antioxidant Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for antioxidant Tenders.

Advance Search
  • All-Tenders (13)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
1 Security Services
image image
Central Government/Public Sector
TRN :35629368 |  24 Oct, 2025
Tender Value : 0
 Varanasi - Uttar Pradesh
Tender for gem bids for aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , levosalbutamol respules , salbutamol 200 mcg rotacap , atenolol 50mg plus amlodipine 5 mg tab , atomoxetine 10 mg tab , atorvastatin 40 mg tab , atorvastatin 80 mg tab , azathioprine 50 mg tab , azelastine 140 mcg plus fluticasone 27.5 mcg nasal spray , azelastine 140 mcg plus fluticasone 50 mcg nasal spray , azelnidipine 8 mg tab , azilasartan 40 mg tab , baclofen 10 mg tab , band aid misc , bandage 10 cm x 4 meters misc , bandage 2.5 cm x 4 metres misc , bandage 6 cm x 4 metres misc , beclomethasone dipropionate 50 mcg plus levosalbutamol 50 mcg inhaler , benidipine hydrochloride 8 mg tab , benidipine hydrochloride 4 mg tab , oint benzoyl peroxide 2.5 percent w by w , povidone iodine gargles misc , oint povidone iodine usp 10 per w by w , betahistine 16 mg tab , betahistine 8 mg tab , betahistine 24 mg tab , oint betamethasone 0.05 per plus salicylic acid 3 per , oint betamethasone 0.1 per plus neomycin 0.5 per , oint betamethasone plus gentamycin , betamethasone 4 mg injection , oint betamethasone plus neomycin plus clotrimazole cream , bethanechol 25 mg tab , bilastine 20 mg dispersible tab , bimatoprost 0.03 per w by v eye drops , biotin 10 mg tab , biotin 10mg, iron 8mg l cysteine 5mg manganese 5mg copper selenium l lysine 20mg zinc 25mg dimethionine 40mg calcium pantothenate 50mg niacinamide50mg tab , biphasic isophane insulin 50 human insulin 50 percrent as soluble insuline plus 50 percent isophan insulin suspension 100iu per ml mixtard 50 3ml cart injection , bisacodyl 5 mg tab , bisacodyl 10 mg tab , bisoprolol 2.5mg tab , bisoprolol 5mg tab , bosentan 62.5 mg tab , brimonidine 0.2 percent w by v eye drops , brimonidine 0.15 percent plus timolol 0.5 percent eye drops , brimonidine 0.2 percent plus timolol 0.5 percent eye drops , brivaracetam 100mg tab , brivaracetam 50mg tab , bromelain 180 mg plus trypsin 96 mg plus rutoside 200 mg , bromhexine 2mg plus guaifenesin 50mg plus menthol 1mg plus terbutaline 1.25mg syp , bromhexine 100 ml syp , sodium hyaluronate 1 mg per ml preservative free phosphate free with comod system eye drop , travoprost 0.004 percent w by v eye drop , efavirenz 600 mg tab , elastic knee support misc , elastic knee support large misc , elastoplast misc , elbow support misc , enalapril 10mg tab , enalapril 2.5 mg tab , enalapril 5 mg tab , entecavir 0.5 mg tab , eplerenone 25 mg tab , escitalopram 10 mg plus clonazepam 0.5 mg tab , escitalopram 20mg tab , escitalopram 5 mg tab , esr disposable piptte misc , esmoprazole 20 mg tab , esomeprazole 20 mg plus domperidone 30 mg tab , esomeprazole 40 mg tab , ethinyl estradiol 0.03mg plus drospirenone 3 mg kit of 21 tab , etizolam 0.5mg tab , etoricoxcib 120mg tab , etoricoxib 60 mg tab , evening promise 1000 cap , everolimus 0.5 mg tab , tobramycin0.3 percent 5 ml eye drop , gentamycin plus hydrocortisone eye drops , ciprofloxacin 0.3 percent eye oint , ezetimibe 10 mg tab , faropenem sodium 200 mg tab , febuxostat 80 mg tab , fenofibrate 145 mg tab , fenofibrate 160mg tab , fenofibrate 200 mg tab , fexofenadine 120 mg plus montelukast 10mg tab , fexofenadine 120mg tab , finasteride 5 mg tab , flavoxate 200mg tab , fluconazole 200 mg tab , flunarizine 10 mg tab , fluocinolone 0.1 percent w by v shampoo lotion , fluoxetine 10 mg cap , fluoxetine 20mg tab , flupiritine maleate 100 mg tab , flurbiprofen 0.03 percent w by v eye drop , fluticasone furoate 27.5 mcg nasal spray , oint fluticasone propionate 0.005 percent , fluticasone propionate 50 mcg bp nasal spray , fluvoxamine 50mg tab , foleys catheter 2 way size 16 fr misc , nifedipine retard 20 mg tab , nitrofurantoin 100 mg cap , nitroglycerin 6.4 mg tab , norethisterone 5mg tab , normal saline bott of 500 ml , nortriptyline 10 mg tab , oint ofloxacin plus orninizole plus itraconazole plus clobetasol cream , oint clobetasol plus salicylic acid , oint acyclovir 5 percent w by w skin cream , oint miconazole nitrate 2.0 percent w by w , olanzapine 10 mg tab , olanzapine 5 mg tab , olmesartan 20 mg tab , olmesartan 40 mg tab , olopatadine 0.2 percent ophthalmic soln bott of 5 ml eye drop , omega 3 fatty acid 500 mg cap , omega fatty acid plus antioxidant cap , ondansetron 4 mg tab , ondansetron 8 mg tab , ondansetron 2 mg per 5ml in bott of 30 ml syp , orciprenaline 10mg tab , ortho arthritis knee brace misc , oxybutynin 2.5 mg tab , pancreatin 10000 iu tab , pancreatine minimicrosphere with lipase 25000 cap , pantaprozole 40 mg plus domperidone 10 mg cap , pantoprazole 40mg plus itopride 150mg cap , pantoprazole 40 mg plus domperidone sr 30 mg cap , pantoprazole 40 mg plus levosulpiride 75 mg cap , paracetamol 1000 mg tab , paracetamol 125mg per 5ml syp , paradichlorobenzene 2 percent w by v plus benzocaine 2.7 percent w by v plus chorbutol 5 percent plus turpentine oil 15 percent w by v ear drop , paroxetin 25 mg tab , paroxetine 12.5mg tab , paracetamol 250 mg plus caffein 100 mg plus ergotamine 1mg plus prochlorperazine 2.5 tab , pentoxifylline 400 mg tab , perindoepril 4 mg plus indapamide 1.5 mg tab , perindopril 4 mg tab , perindopril 8 mg tab , oint permethrin 5 percent w by w tube of 30 gm , permethrin 5 percent w by v lotion , pheniramine maleat 25mg tab , phenobarbitone 30 mg tab , phenytoin sodium 100 mg tab , pioglitazone 15 mg tab , pioglitazone 30mg tab , piracetam 400 mg tab , piracetam 800 mg tab , piroxicam 20mg tab , pitavastatin 2 mg tab , torsemide 100 mg tab , torsemide 10 plus spironolactone 50 mg tab , torsemide 20 mg tab , torsemide 5 mg plus spironolactone 25 mg tab , tramadol 50 mg cap , tramadol plus dicyclomin plus acetaminophen tab , tranexamic acid 500 mg plus mefenamic 250 mg tab , tranexamic acid 500 mg tab , oint tretinoin 0.025 percent oint , oint tretinoin 0.05 percent oint , triamcinalone 40mg injection , oint triamcinolone acetonide 0.1 percent for oral use tube of 5 gm , trifluoperazine 5 mg tab , trihexyphenidyl 2mg tab , trimetazidine 20 mg tab , trimetazidine mr 35 mg tab , tropicamide 0.5 percent with 5 percent phenylephrine bott of 5 ml eye drop , tropicamide eye solution 1 percent bott of 5 ml eye drop , trypsin and chymotrypsin 6 is to 1 100000 au enteric coated tab , trypsin, chymotrypsin, diclofenac chymoral forte d tab , typhi dotkit of 50 test lab , ubidecarenone 300mg tab , ubiquinol acetate 100 mg tab , oint urea cream, urea 10 to 12 percent lactic acid 5 to 10 percent in pack of 50 gm , kits for estimation of urea lab , uric acid lab , urinary bag misc , uristick bott 100 strip lab , ursodeoxycholic acid 300 mg tab , valsartan 40 mg tab , venlafaxine 37.5mg tab , vericiguat 2.5 mg tab , vildagliptin 50mg tab , vit a d e c b1 b12 folic acid biotin menopace tab , vitamin a 50000 iu cap , oint volini gel tube of 50 gm linseed oil plus diclofenac plus methyl salicylate plus menthol gel , warfarin 5 mg tab , widal test kit lab , nasal decongestant adult drops xylometazoline hcl 0.1 percent w by v bottle of 10 ml nasal drop , xylometazoline 10 ml nasal drop , xylometazoline hydrochloride 0.1 percent nasel spray , ziprasidone 20 mg tab , zolpidem 10 mg tab , zolpidem 5 mg tab , zonisamide 50 mg tab , novopen needle all size misc , topiramate 25 mg tab , topiramate 50mg tab , oxetacaine aluminium hydroxide and magnesium hydroxide anesthetic antacid gel syp
  • View Tender
  • Document
  • Bid Support
2 Security Services
image image
Central Government/Public Sector
TRN :35608354 |  23 Oct, 2025
Tender Value : 27.58 Lacs
 Kangra - Himachal Pradesh
Tender for gem bids for medicine, 5 amino salicylic acid 400 mg mesalamine acebrophylline 200 mg sr aceclofenac 100 andparacetamol 325 and chloroxazone 250 tab hifenac mr aceclofenac 100 mg andthiocolchicoside 4 mg tab aceclofenac sr 200mgtab acenocoumarol acitrom 4 mg tab alfuzosin10 mg and dutasteride 05 mg tab amisulpride 100mg tab amitriptyline 10 mg tab amlodepine 10 mgtab apremilast 30 mg tab aspirin 150 mg andclopidogrel 75 mg aspirin 75 mg and atorvastatin10 mg tab atorvastatin 40 mg tab azelnidipine 8mg tab barrier cream 4720 bisacodyl dulcolax 5 mg tab bisoprolol 5mg tab bromhexine 2mg and guaifenesin 50mg and menthol 1mg andterbutaline 125mg syrup bupropion 150 mg tab calcium acetate 667 mg tab calcium dobesilate tab oxerute catheter foleys silicon 2 way size 22 fg cefixime 200mg and clavulanate 125 mg tab cefpodoxime 200mg and clavulanate 125 mg cap cefpodoxime proxetil 50 mg syp oral suspension chlordiazepoxide 10 mg librium tab chlordiazepoxide 5 mg and clidinium bromide 25 mg librax 5 and 25 chlorthalidone 625 mg tab cilnidipine 10 mg and telma 40 mg tab cilnidipine 10mg tab cilnidipine 5 mg tab cilostazol 100 mg tab cilostazol 50mg tab cinnarizine 75 mg tab clobazam 10mg tab clonazepam 025 mg tab clonazepam 05 mg tab clopidogrel 75 mg andaspirin 75 mg tab clotrimazole 100mg vaginaltablets coenzyme q-10 100 mg tab coloplastpaste 2650 coloplast starp braua elastic tape colostomy bag 60 mm combipack of amoxicillin750mg and tinidazole 500 mg and omeprazole 20 mg bid number gem2025b6757183 dated 13-10-2025 bid document1 145 1 1 hp kit, , corn cap, cough lozenges, daflon 500mg, diosmin 450mg and hesperidin 50mg, tab, dapagliflozin 10 mg and metformin 500 mg tab, dapaglifozin 5 mg tab, deflazacort 6 mg tab, dengue serology rapid kit, desloratadine 10 mgtab, dexamethasone 4mg tab, diazepam 5mg tab, digital x- ray film 10 x 8 agpha, diltiazem cd 120 cap, tab, disodium hydrogen citrate syrup, donepezil5mg and memantine 10mg tab, dosulepin 25 mg, dothiepin, tab, dressing medicated gauze paraffin, 10 cm x10 cm, tin of 24, drotaverine hcl 40 mg tab, ed fluorometholone acetate, etizolam 0.5mg tab, etoricoxib 60 mg tab, filgrastim 300 mcg inj, flupentixole 3 mg tab, gamma tocotrienol deltatocotrienol 400 mg cap, gatiflox and prednisolone10ml eye drops, gatifloxacin 0.3percent eye dropbott of 5 ml, e, d, , glibenclamide 5 mg tab, gliclazide 40 mg tab, glimepride 1 mg and metformin500 mg tab, glimepride 2 mg and metformin 1000 mgsr tab, glipizide 5 mg tab, glucosamine 500 mg anddiacerin 50 mg tab, glucosamine 750 mg anddiacerine 50 mg and msm 200 mg tab, glutathione250 mg tab, glutathione 500 mg tab, glycerylnitrate 2.6 tab, glyceryl nitrate 6.4, nitrocontin, tab, hyaluronic acid 20 mg, hyalgan inj, hydralazine 37.5 and isisorbide dinitrate 20 mg tab, isolazine, , hydroxyurea 500 mg cap, hydroxyzine10 mg tab, ibuprofen 400 mg tab, iguratimod 25 mgtab, imeglimin 500mg tab, indomethacin 25 mg cap, inj biovic 90mg, sodium hyaluronate, , injdenosumab solution 60 mg, ml, prollia, , injerythropoietin recombinant human 5000 iu, injhuman mixtard 30-70, inj iron sucrose, injmethylcobalamin, 1000mcg, and vitamin b6, pyridoxine, , 100mg, and nicotinamide, 100mg, , neurobion, , inj methylcobalamin 1500 mcg, injnandrolone decanoate 25mg, ml, isotonic nasalspary, ivermectin 12mg tab, lenvatinib 4mg tab, levodopa, 100mg, and carbidopa, 25mg, tab, levodopa 100mg and carbidopa 25mg and entacapone200mg, syncapone tab, levosulpiride, 75mg, andesomeprazole, 40mg, cap, lithium carbonate 300mg cap, tab, losartan 50mg andhydrochlorthiazide 12.5mg tab, macvestin 500mgtab, univestin, , mesalamine 1 gm sachet, metolazone 5mg tab, metoprolol xl 12.5 mg tab, midodrine 2.5 mg tab, nebivolol 2.5 mg tab, neomercazole, carbimazole, 10mg tab, nepafenac, 0.3percent w, v, 5 ml ed, nifedipine retard 20 mgcap, tab, nifedipine xl 30 mg tab, olopatadine0.1percent bottle of 5 ml e, d, omega 3 fatty acidcap, omega fatty acid and antioxidant cap, oralteething sol, zytee mouth lotion, 10ml, ostomyadhesive remover spray, pantoprazole 40 andclarithromycin 500 and amoxycilin 750, paradichlorobenzene 2percent w, v and benzocaine2.7percent w, v and chorbutol 5percent andturpentine oil 15percent w, v ear drop, clear wax, , penicillamine 250mg tab, pentoxifylline, 400mg, tab, trental, , pioglitazone 15 mg tab, pioglitazone 30mg tab, piroxicam 20mg tab, polyethelen glycol and propylene glycol, systane, e, d, pramipexole 0.125 mg tab, pregabalin 75 mgand nortriptyline 10 mg and methylcobalamin 1500    //bid details2 / 145 mcg tab, pregabalin 75 mg and ntp 10 mg tab, rabeprazole 20 mg and levosulpride 75mg tab, rabeprazole 20mg and domeperidon 10mg tab, rasagiline 0.5 mg tab, rasagiline 1 mg tab, repaglinide 1mg tab, repaglinide 2 mg tab, rosuvastatin 40 mg tab, s adenosyl l-methionine200 mg tab, s adenosyl -l-methionine 400 mg tab, adesam, , sacubitril 97mg and valsartan 103mg tab, selegiline 5 mg tab, sildenafil 20 mg tab, sildenafil25 mg tab, silodosin 8 mg and dutasteroide 0.5 mgtab, sodium cromoglycate 4percent eye drop, cromal forte, , sotalol 40 mg tab, sterile gauze 4x 4 pkt of 5, syp alpha - amylase pepsin, digestiveenzyme, , syp paracetamol 162 mg and ibuprofen 100mg 60 ml, tacrolimus 0.25 mg tab, tacrolimus0.3percent oint, tacrolimus 2 mg tab, telmisartan 40and amlodipine 5 mg tab, telmisartan 40 mg tab, telmisartan 40 mg and amlodipine 10 mg tab, telmisartan 80 mg tab, tenofovir 300 andlamivudine 300mg and dolutegravir 50mg, tenofovir 300 mg and lamivudine 300 mg andefavirenz 600 mg tab, tenofovir alafenamide 25 mgtab, tetrabenzeme 25mg tab, thiocolchicoside 8mg, myoril, tab, thyroxin 12.5mcg, thyroxine 75mcg tab, ticagrelor 60 mg tab, brilinta, , timololmaleate eye drop 0.5percent bott of 5 ml, tofacitinib11 mg tab, tolterodine 2 mg tab, torsemide 10 andspironolactone 50 mg tab, torsemide 20 mg tab, torsemide 5 mg and spironolactone 25 mg tab, torsemide 5 mg tab, triamcinalone 40mg, kenakort, inj, urostomy bag -60mm, verapamil 40mg tab, vericiguat 10 mg tab, vericiguat 2.5 mg tab, warfarin 1mg tab, warfarin 2mg tab, warfarin 5mg tab, zolpidem 10 mg tab, novopen needle, allsize, , enzalutamide 160 mg, tegafur 20 mg andgimeracil 5.8 mg and oteracil 15.8 mg, simyl mct oil of500 ml, almond oil of 300 ml, raughan -e-shireen, , uncooked corn starch 400 gm, weikfield, , disposabletube westergreen esr, heamolynac 3n, 680g, 500 ml, cleanac, mek 520, pack of 5 ltr, cleanac, mek 620, pack of 5 ltr, micro tips 1-200 ul pkt of 1000, needle24g, tourniquet, vitamin b12, finecare, rapidquantitive test, 25x8, finecare t3, 25test packing, , finecare t4, 25 test packing, , finecare tsh, 25 testpacking, , finecare hba1c, 25tesst packing, , finecare vitd, 25 test packing, 5 amino salicylic acid 400 mg mesalamine, acebrophylline 200 mg sr, aceclofenac 100 + pcm325 + chloroxazone 250 tab hif, aceclofenac 100mg + thiocolchicoside 4 mg tab, aceclofenac sr200mg tab, acenocoumarol acitrom 4 mg tab, alfuzosin 10 mg + dutasteride 0.5 mg tab, amisulpride 100 mg tab, amitriptyline 10 mg tab, amlodepine 10 mg tab, apremilast 30 mg tab, aspirin150 mg+ clopidogrel 75 mg, aspirin 75 mg +atorvastatin 10 mg tab, atorvastatin 40 mg tab, azelnidipine 8 mg tab, barrier cream 4720, bisacodyldulcolax 5 mg tab, bisoprolol 5mg tab, bromhexine 2mg + guaifenesin 50mg 1.25mgsyrup, bupropion 150 mg tab, calcium acetate 667 mgtab, calcium dobesilate tab oxerute, catheterfoleys silicon 2 way size 22 fg, cefixime 200mg +clavulanate 125 mg tab, cefpodoxime 200mg +clavulanate 125 mg cap, cefpodoxime proxetil 50 mgsyp oral suspension, chlordiazepoxide 10 mg    //bid details3 / 145
  • View Tender
  • Document
  • Bid Support
3 Security Services
image image
Central Government/Public Sector
TRN :35608710 |  25 Oct, 2025
Tender Value : 37.99 Lacs
 Jaipur - Rajasthan
Tender for gem bids for echs, omega fatty acid plus antioxidant cap, paracetamol500mg plus ibuprofen 400mg tab, propyl thiouracil 50mgtab, pyridoxine 40 mg tab, rabeprazole 40 mg tab, rasagaline 0point5 mg tab, rasagaline 1 mg tab, repaglinide 1mg tab, repaglinide 2 mg tab, respulelevosalbutamol 0point63mg in 2point5 ml, riluzole 50mgtab, risperidone prolonged release suspension, rivoraxaban 2point5 mg tab, rizatriptan 5 mg tab, ropinirole 0point5 mg tab, ropinirole 2 mg tab, safinamide 50 mg tab, savlon liquid, chlorhexidinesolution containing, secnidazole 1000 mg tab, sodiumhypochlorite solution 5percentage, can of 5 ltr, sodiumvalproate plus valproic acid acid 200 mg tab, sofosbuvir400 mg plus daclatasavir 60 mg tab, solifenacin 5 mg tab, spironolactone 50 mg, spray melatonin 1point5 mg spray, sulphacetamide 20percentage wpointv eye, sumitriptan50 mg tab, syp lactulose 10 gm 15 ml, bott of 200 ml, syp liver tonic liv 52, tab sodium valproate 500 mg crsodium, tadalafil 20 mg tab, tadalafil 5 mg tab, tapentadol 50 mg tab, terbinafine 1percentage cream, tube of 10 gm, tianeptine 12point5 mg tab, timololmaleate 0point05percentage eye drop, , trimetazidine 20mg tab, voglibose 0point3mg tab, zolpidem 5 mg tab  /bid number: gem/2025/b/6735983* /dated: 11-10-2025  & & / bid document1 / 35
  • View Tender
  • Document
  • Bid Support
4 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
5 Crude Oil/Natural Gas/Mineral Fuels
image image
corporations/Associations/Others
TRN :35591307 |  31 Oct, 2025
Tender Value : 0
 Visakhapatnam - Andhra Pradesh
Tender for gem bids for rate contract for antioxidant 2, 6 dbpc
  • View Tender
  • Document
  • Bid Support
6 Railway Transport
image image
Central Government/Public Sector
TRN :35554160 |  20 Oct, 2025
Tender Value : 0
 Gorakhpur - Uttar Pradesh
Tender for supply of cap. antioxidant.
  • View Tender
  • Document
  • Bid Support
7 Security Services
image image
Central Government/Public Sector
TRN :35530863 |  24 Oct, 2025
Tender Value : 0
 East Khasi Hills - Meghalaya
Tender for gem bids for baclofen, baclofen 10mg tab, tab etoricoxib 90mg, naproxen250mg tab, tramadol hcl 50mg cap or tab, indomethacin75mg sr tab, amoxycillin 250mg cap, cremaffin whiteeach 15ml containing milk of magnesia 11 point 25ml andliq paraffin 3 point 75ml bott of 170ml, tab sodiumbicarbonate 500mg, probiotic lactobacillus sporogenes capmultibacillary 4 or more organism, mebeverin hcl 135mgtab, isabgol husk 3 point 5 gm, loperamide 2mg tab, tabitopride 50mg, tab phenytoin sodium 100mg, levetiracetam 500mg tab, oxcarbazepine 300mg tab, alprazolam 0 point 25 mg tab, levodopa 125mg withcarbidopa 25mg tab, tab lithium corbonate 300mg, pregabalin 75mg cap or tab, gabapentin 300mg cap, tabmethylcobalamine 1500mcg, trihexyphenidyl hcl 2mg tab, phenobarbitone 30mg tab, carbamazepine 200mg tab, soft gelatin antioxidant cap, chondoitin sulphate plusglucosamine plus diacerin tab, alendronate sodium 70mgtab, heamatinic tab or cap containing ferrous fumarate100mg elemental iron folic acid 500 to 1500mcg, n acetylcysteine 600mg tab, folic acid 5mg tab, tenofovir 300mgtab plus tab lamivudine 150mg plus tab efavirenz 600mg, tab tenofovir 300mg, montelukast 4mg plus levocetrizine2 point 5mg combination tab, tacrolimus 0 point 5mg tab
  • View Tender
  • Document
  • Bid Support
8 Railway Transport
image image
Central Government/Public Sector
TRN :35521381 |  23 Oct, 2025
Tender Value : 0
 Lucknow - Uttar Pradesh
Tender for supply of antioxidant capsule containing at least one omega 3 fatty acid + etc if any.
  • View Tender
  • Document
  • Bid Support
9 Security Services
image image
Central Government/Public Sector
TRN :35486509 |  18 Oct, 2025
Tender Value : 0
 Aurangabad (Mh) - Maharashtra
Tender for gem bids for faropenem sodium 200 mg tab fenofibrate 160 mg tab fenofibrate 200 mg tab fexofenadine hydrochloride 120mg tab finasteride 5 mg tab flavoxate 200 mg tab fluconazole 150 mg cap tab flunarizine 10 mg tab fluoxetine hcl 20 mg cap flupentixol 05 mg andmelitracen 10 mg tab flurometholone 01 percent eyedrop bott of 5 ml fluticasone furoate 100 mcg andvilanterol 25 mcg rotacaps fluticasone propionate 50 mcgnasal spray foleys balloon catheter silicon 2 way 18 fg foleys balloon catheter silicon 2 way16 fg formoterol 6mcg and glycopyrronium 25 mcg dry powder fosfomycinsachet 3 gm framycetin sulphate 1 percent cream 15 20gm fructooligosaccharide and bifido bacterium andstreptococ human coagulation factor ix 600 iu vial frusemide 40 mg tab gabapentin 100 mg cap tab gauze surgical open woven 1 mtr pkt ginkgo biloba tab gliclazide 40 mg tab gliclazide 80 mg tab glimepiride 1mg tab glipizide 5 mg tab gloves size 65 powdered gloves size 75 powdered gluco strips for glucometeraccuchek active 50 strips per glucosamine 250 mg andchondroitin sulphate 200 mg cap glutamine sachet glycopyrronium 25 mcg smartules halobetasol 005percent w v oint 20 gm haloperidol 025 mg tab haloperidol 5 mg tab human coagulation factor viii 500iu inj vial human insulin 40 iu vial of 10 ml humanactrapid human insulin analogue long acting 100 iu ml pfsof 3 ml human insulin analogue rapid acting inj 100 iu mlrecomb hydrochlorthiazide 125 mg tab hydrocortisonesodium succininate 100 mg inj vial of 10 ml hydroxychloroquine 200 mg tab hydroxyzine 10 mg tab indapamide sr 15 mg tab infusion normal saline sodiumchloride 09 percent w v inosine monophosphate 500 mgand l arginine 250 mg and insulin aspart 30 percent and bid number gem2025b6717774 dated 27-09-2025 bid document1 106 1 1 insulin aspart protamine 70 p, insulin syringes with bdultra fine needle 40u 31g 6mm, insuline pen needle 31g, iron with vitamin b 12 and folic acid bott of 200 ml syrup, isapgol ispaghula husk 3.5 gm sachet, isosorbidemononitrate 20 mg tab, isotretinoin 10 mg cap, itopride150 mg tab, itopride 50 mg tab, ketoconazole 2 percentshampoo bott of 75 ml, ketorolac 10 mg tab, knee capelastic large, knee cap elastic xl, lacosamide 100 mg tab, lactobacillus 1 gm sachet, latanoprost 0.005 percent w veye drop bott of 2.5 ml, leflunomide 10 mg tab, leflunomide 20 mg tab, lenvatinib 4 mg tab, letrozole2.5 mg tab, levocarnitine 500 mg tab, levo cetirizine 5mg tab, levodopa 100 mg and carbidopa 10 mg tab, levodopa 100 mg and carbidopa 25 mg tab, levofloxacin500 mg tab, levosabutamol 1.25 mg respules amp of 2.5ml, levosalbutamol 1.25 mg and ipratropium 500 mcg in2.5 m, levosalbutamol 50 mcg and beclomethasone 50mcg inhaler, lignocaine hcl jelly 2 percent tube of 30 gmwith sterile tu, linagliptin 5 mg tab, linezolid 600 mg tab, loperamide 2mg tab, lorazepam 2 mg tab, losartan 25mg tab, losartan 50 mg tab, loteprednol etabonate 0.5percent bott of 5 ml, luliconazole cream tube of 15 gm, ls belt size l, ls belt size xl, mebeverine hcl 135 mgtab, medroxy progesterone 10 mg tab, mefenamic acid250 mg and dicyclomine hcl 10 mg tab, memantine 5 mgand donepezil 5 mg tab, memantine 5 mg tab, mesalamine 1 gm sachet, mesalamine 1.2 gm tab, mesalamine suppository, methotrexate 10 mg tab, methotrexate 2.5 mg tab, methotrexate 5 mg tab, methylcobalamin 1000 mcg and vitamin b6 pyridoxine, methylcobalamin 1500 mcg and alpha lipoic acid 100 mg, methylcobalamin 1500 mcg tab, methylcobalamin 500 mcgtab, methylprednisolone 4 mg tab, metronidazole andchlorhexidine and lignocain oral g, metronidazole 400 mgtab, miconazole nitrate 2 percent skin tube of 15 gmcream, mirabegron 25 mg tab, modafinil 100 mg tab, monteleukast 10 mg tab, montelukast 10 mg andlevocetirizine 5 mg tab, moxifloxacin 0.5 percentpreservative free eye drops, moxifloxacin hcl 0.5 percentand dexamethasone 0.1 pe, moxonidine 0.2 mg tab, moxonidine 0.3 mg tab, mupirocin 2 percent oint tube of 5gm, mycophenolate 500 mg tab, mycophenolate sodium180 mg tab, naproxen 250 mg tab, naproxen 500 mg tab, nasal decongestant adult drops xylometazoline hcl 0.1, nebivolol 5mg tab, neomycine powder, nepafenac 0.3percent w v eye drop 5ml, neurobion forte tab, nicorandil5 mg tab, nifedipine retard 10 mg tab, nifedipine retard20 mg tab, nintedanib 150 mg soft gelatin capsules, nitrofurantoin 100 mg cap tab, nitroglycerin 2.6 mgcontrolled release tab, nitroglycerin cr 6.4 mg tab, nonsterile gloves medium size, non sterile gloves small size, nor ethisterone 5mg tab, norfloxacin 400 mg tab, nortriptyline 25 mg tab, ofloxacin 200 mg tab, olmesartan medoxomil 20 mg tab, olmesartan medoxomil40 mg tab, olopatadine 0.1 percent eye drop of 5 ml, omega fatty acid and antioxidant cap, omeprazole 20 mgcap, ondansetron 8 mg tab, oral rehydration powdersachet of 20.5 g each contain, orciprenaline 10 mg tab, oxcarbamazepine 300 mg tab, oxcarbazepine 150 mg tab, pancreatine minimicrosphere and lipase 25000 cap, pantoprazole 40 mg inj vial of 10 ml, pantoprazole 40 mgtab, para dichlorobenzene 2 percent w v benzocaine 2.7 pe, paracetamol 325 mg and ibuprofen 400 mg tabfaropenem sodium 200 mg tab, fenofibrate 160 mg tab, fenofibrate 200 mg tab, fexofenadine hydrochloride 120    //bid details2 / 106
  • View Tender
  • Document
  • Bid Support
10 Security Services
image image
Central Government/Public Sector
TRN :35490778 |  20 Oct, 2025
Tender Value : 0
 Dimapur - Nagaland
Tender for gem bids for 0 0 tab pantoprazole 40 mg, tab azithromycin 500 mg, tabcefixime 200 mg, tab amoxycillin 500 mg and potclavulanate 125 mg, tab diclofenac sodium 50 mg, tabaceclofenac and paracetamol and chlorzoxazone, tabcetrizine 10 mg, tab itraconazole 200 mg, tab antacid, tab promethazine theoclate 25 mg, syp antacid, sypparacetamol 125 mg, syp cefixime 50 mg per 5 ml bott of30 ml, ciprofloxacin 0.3 percent eye drops 3mg per ml bottof 5 ml, oint diclofenac gel 30 gm, diclofenac spray, tabcalcium 500 mg shelcal, cap rabeperazole anddomperidone, syp combifalm, syp dicyclomine hcl andsimethicone, syp albendazole, syp ondansetron, eardrop para dichlorobenzene benzocaine urpentine oil bott of10 ml waxole, lotion calamine bott of 100 ml, ointluliconazole, tab ibuprofen and paracetamol, tabderiphylline, tab clotrimazole vaginal pessaries, tabbisacodyl 10 mg, tab pheniramine maleate 25 mg, tabanticold, syp iron, syp cough expectorant 100 ml, sypcetrizine, syp azithromycin 200 mg, amoxycillinclavulanic acid syp in 30 ml bott, oint clobe gm, dropnasovion paed, drop nasovion adult, band aid, asthallininhaler, tab diclofenac potassium and serratiopeptidase, tab doxycycline 100 mg, tab ondansetron 8 mg, tabfluconazole azithromycin and secnidazole combikit, tabetophylline and theophylline sr, tab salbutamol 4 mg, tab haematinic, tab amlodipine 10 mg, cap becosule z, oint dipsalic, oint povidone, crepe bandage 10 cm, rollerbandage 10 cm, cotton 50 gm, gamma benzenehexachloride and cetrimide emulsion, lotion povidoneiodine 10 percent bott of 100 ml, eye drop gentamycin, ear drop chloramphenicol benzocaine propylene glycol, syp metronidazole, syp norflox 30 ml, sypdiphenhydramine ammonium chloride sod citrate mentholbott of 100ml, syp diphenhydramine hcl ammoniumchloride sod citrate ethanol bott of 100ml, sypmultivitamin multimineral and antioxidant 100 ml, syp bcomplex 100 ml, syp asthalin, syp tixliyx    //bid details2 / 47
  • View Tender
  • Document
  • Bid Support
  • 1
  • 2
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Related Searched Keywords : antioxidant
  • Aquaseal Tenders ,
  • Flocculant Tenders ,
  • Rubidium Chloride Tenders ,
  • Gypsum Zinc Sulphate Tenders ,
  • Tallow Tenders ,
  • Cupric Sulphate Tenders ,
  • Powder Mixture Tenders ,
  • Sodium Meta Bi Sulphite Tenders ,
  • Basic Organic Chemicals Tenders ,
  • Carbon Molecular Sieve Tenders

Get antioxidant Tender Alert...

607441

Related Searched Keywords : antioxidant

  • Wall Work Tenders From Maharashtra
  • Underground Sewer Tenders From Delhi
  • Interlocking Tile Flooring Tenders From West-Bengal
  • Flooring Item Tenders From -Tamil-Nadu
  • Check Dam Tenders From Andhra-Pradesh
  • Embankment Tenders From Gujarat
  • Site Preparation Work Tenders From Karnataka
  • Bore Work Tenders From Uttar-Pradesh
  • Desilting Work Tenders From Rajasthan
  • Lake Development Tenders From Madhya-Pradesh

Read More


Tender Document

433622

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Renovation Work Tenders
  • Development Work Tenders
  • Flood Gate Tenders
  • Infrastructure Works Tenders
  • Bore Wells Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.in / ceo@thetenders.in

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App