Filters

List of amylase Tenders

List of latest amylase Tenders in Indian Tenders. Click on any amylase Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for amylase Tenders.

All-Tenders (20)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35619638 | 27 Oct, 2025

Tender Value : 20.86 Lacs

Gwalior - Madhya Pradesh

Tender for gem bids for lab, occult blood test kit kit of 50 tests zn stain kitreadymade gram stain kit readymade blood agar baseinfusion agar hi media cled agar with thymol blue macconkey agar nutrient agar mac conkey broth hi mediadouble strength bott of 500 gm mac conkey broth himedia single strength bott of 500 gm hi mediabiochemical test kit kb002 20 kit per pack mac conkeybroth 15 x 10 ml kit of 50 abst disc ampicillinsulbactum abst disc amikacin abst disc cefoxitin abst disc clindamycin abst disc gentamycin abstdisc cotrimoxazole abst disc imipenam abst discofloxacin abst disc linezolid abst discteicoplanin abst disc erythromycin abst disctetracycline abst disc vancomycin abst disclevofloxacin abst disc meropenam abst discceftazidime abst disc ceftriaxone abst discciprofloxacin abst disc nitrofurantoin abst discnetilmycin abst disc tobramycin abst discaztreonam abst disc colistin abst discamoxycillin clavulanic acid abst disc cefepime abst disc polymixin b abst disc bacitracin abstdisc optochin abst disc cefuroxime abst discpiperacillin tazobactam abst disc cefadroxil abst disc norfloxacin abst disc trimethoprimsulfamexthoxazole abst disc ticracillinclavulanic acid diamond glass writing liquorformaldehyde 40 percent w oblique v paraffin wax melting56 degree centrigrade to 60 degree centrigrade replacesglass cover microscopic rectangular pv 16442 22 x 50 mmmade of usp no 1 glass pkt of 14 gm replaces glass covermicroscopic rectangular pv 16446 22 x 40 mm made of uspno 1 glass pkt of 14 gm glass cover microscopicrectangular 22x30 mm made of usp no 1 glass slide bid number gem2025b6726583 dated 12-10-2025 bid document1 72 0 0 microscope thickness 1 point 15 to 1 point 35 mm size 75mm x 25 mm, alcohol dehydrated ethanol, xylene xylolpure, tissue cassettes plastics, whatman filter paperdiameter 125 mm cat no 1001 to 125, couplin jar, diluent celquant edge 20 ltr, lyse celquant edge 500 ml, rinse celquant edge 5 ltr, enzyme cleaner celquant edge70 ml, probe cleaner celquant edge 50 ml, print roll size76 mm, g6pd kit of 10 test, prothrombin time reagents togive control of 10 to 14 secs, binocular microscope bulbs, alcohol methyl, bovine albumin 22 percent, anti h lactin, serum anti human globulin, serum haemaglutinating gpab anti ab monoclonal, disposable lancet for finger prickpkt of 100, serum haemaglutinating gp b anti amonoclonal, serum haemaglutinating gp a anti bmonoclonal, elisa reader thermal paper for, distilled water, tissue paper roll, crp rapid kit 35 test each, widal testkit 4 x 5 ml 50 tests per kit, dextrose monohydrate powder100 gm, cotton wool non absorbent pkt of 500 gm, syringe disposable plastic sterile 2 ml with needle, syringedisposable plastic sterile 5 ml with needle, syringedisposable plastic sterile 10 ml with needle, cotton woolabsorbent pkt of 50 gm, cotton wool absorbent pkt of 500gm, gauze absorbent folded 2 point 5 cm x 100 meters, lint absorbent cotton, surgeons mask disposable, steriledisposal hand glove 7 size powder free, chloroxylenesolution dettol, disposable gown and cap and mask set, alcoholic hand disinfectant rub containing 2 propanol ip 45gm 1 propanol ip 30 gm ethyl hexadecyl dimethylammonium ethyl sulphate point 2 gm mecetronium ethylsulphate 100 ml bott, sodium hypochlorite 5 percent, vaccutainer sterile glass 4 ml yellow, phenol carbolic acidbott of 500 ml, amylase, lipase, bio norm, bio path, biocal, sample cup, cholesterol, total protein, triglycerides, hba1c, hdl cholesterol, creatinine kinase nac, po2membrane, calibration pack ultra 1 with creatinine, ultrachem 9 internal qc multipack without creat, ultra abg gasauto qc pack, pco2 membrane, so2 percent calibrationampoules

Central Government And Public Sector

TRN :35623067 | 25 Oct, 2025

Tender Value : 0

Kota - Rajasthan

Tender for gem bids for glucose system pack reagent for bio-chemistry analyzer mindray bs -480 total cholestrol system pack reagent for bio-chemistry analyzer mindray bs-480 hdl cholestrol system pack reagent for bio-chemisrty analyzer mindray bs-480 ldl cholestrol system pack reagent for bio-chemisrty analyzer mindray bs-480 trigliceride system pack reagent for bio-chemisrty analyzer mindray bs-480 blood-urea system pack reagent for bio-chemisrty analyzer mindray bs-480 uric-acid system pack reagent for bio-chemisrty analyzer mindray bs-480 bilirubin-total system pack reagent for bio-chemisrty analyzer mindray bs-480 bilirubin-direct system pack reagent for bio-chemisrty analyzer mindray bs-480 sgot system pack reagent for bio-chemisrty analyzer mindray bs-480 sgpt system pack reagent for bio-chemisrty analyzer mindray bs-480 alkaline phosphatase system pack reagent for bio-chemisrty analyzer mindray bs-480 serum creatinine system pack reagent for bio-chemisrty analyzer mindray bs-480 cpk-nac system pack reagent for bio-chemisrty analyzer mindray bs-480 cpk-mb system pack reagent for bio-chemisrty analyzer mindray bs-480 ldh system pack reagent for bio-chemisrty analyzer mindray bs-480 calcium system pack reagent for bio-chemisrty analyzer mindray bs-480 total protein ystem pack reagent for bio-chemisrty analyzer mindray bs-480 phosphorus system pack reagent for bio-chemisrty analyzer mindray bs-480 amylase system pack reagent for bio-chemisrty analyzer mindray bs-480 albumin system pack reagent for bio-chemisrty analyzer mindray bs-480

Central Government/Public Sector

TRN :35608164 | 31 Oct, 2025

Tender Value : 2.69 Lacs

Hazaribagh - Jharkhand

Tender for gem bids for trichloroacetic acid emplura, tiba, 2 4 d, iaa, naa, 6bap, kinetin, chitosan, aba, ccc, jasmonic acid, ethephon, maleic hydrazide, melatonin, prohexadionecalcium, colchicine, alpha amylase, sodium phosphate, sodium thiosulphate, trolox, tptz, absolute ethanol, trisbuffer ar, edta dipotassium, tris hydrochloride, caffeicacid, caffeine, naringenin, chloroform, water nucleasefree, cetyltrimethyl ammonium bromide ctab, nitro bluetetrazolium chloride nitro bt nbt, sodiumdiethyldithiocarbamate trihydrate acs, sodiumthiosulphate pentahydrate, cellulase, protease, petroleumether, sulphosalicylic acid, glutathione oxidized, polyethylene glycol, naringin, limonin, murashige andskoog basal salt mixture ms

Central Government/Public Sector

TRN :35610100 | 18 Nov, 2025

Tender Value : 0

Bhopal - Madhya Pradesh

Tender for supply of pancreatin mini microspheres equivalent pancreatin mini microspheres equivalent to pancreatin 300 mg with declared enzyme activity amylase 18000 peu/u, lipase 25000 peu/u & protease 1000 peu/u creon 25000..

State Government

TRN :35610174 | 29 Oct, 2025

Tender Value : 10.00 Crore

Chandigarh Ut - Chandigarh

Tender for gem bids for reagent kit sodium for 05 years, reagent kit potassium for05 years, reagent kit chloride for 05 years, reagent kitglucose for 05 years, reagent kit urea for 05 years, reagent kit creatinine for 05 years, reagent kit uric acidfor 05 years, reagent kit calcium for 05 years, reagent kitphosphorus for 05 years, reagent kit magnesium for 05years, reagent kit total bilirubin for 05 years, reagent kitconjugated bilirubin for 05 years, reagent kit alkalinephosphatase for 05 years, reagent kit sgot for 05 years, reagent kit sgpt for 05 years, reagent kit total protein for05 years, reagent kit albumin for 05 years, reagent kitggt for 05 years, reagent kit amylase for 05 years, reagent kit lipase for 05 years, reagent kit total ck for 05years, reagent kit cpkmb for 05 years, reagent kit crp for05 years, reagent kit hscrp for 05 years, reagent kit rafactor for 05 years, reagent kit cholesterol for 05 years, reagent kit tg for 05 years, reagent kit hdl for 05 years, reagent kit ldl for 05 years, reagent kit apoa for 05 years, reagent kit apob for 05 years, reagent kit ada for 05years, reagent kit ldh for 05 years, reagent kit iron for05 years, reagent kit d dimer for 05 years, reagent kithba1c for 05 years, reagent kit cystatin c for 05 years, reagent kit ammonia for 05 years, reagent kit urinarytotal protein for 05 years, reagent kit csf total protein for05 years, reagent kit urinary albumin for 05 years, reagent kit urinary microalbumin for 05 years, reagent kitinsulin for 05 years, reagent kit ft3 for 05 years, reagentkit ft4 for 05 years, reagent kit tsh for 05 years, reagentkit vitamin d for 05 years, reagent kit vitamin b12 for 05years, reagent kit psa for 05 years, reagent kit afp for 05years, reagent kit ca 125 for 05 years, reagent kit ceafor 05 years, reagent kit cortisol for 05 years, reagent kitferritin for 05 years, reagent kit ipth for 05 years, reagent kit pct for 05 years, reagent kit total hcg for 05years

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35614830 | 03 Nov, 2025

Tender Value : 10.00 Lacs

Aizwal - Mizoram

Tender for gem bids for pharmacy, eudragit, phloroglucinol ar, potassium phosphate, phosphate buffer, phosphate buffer saline, phosphateglycol, phosphatidylcholine, p nitrophenyl glucopyranoside, poloxamer, poly vinyl pyrrolidone, polyethylene glycol, potassium chloride, potassium ferricyanide, potassiumhydroxide, potassium iodobismuth, potassium mercuriciodide, potassium phosphate buffer, potassium phosphatemonobasic, potassium sodium tartrate, potato dextroseagar, povidone iodine ointment, propyl paraben, quercetin, safranin, serum glutamic oxaloacetictransaminase, serum glutamic pyruvic transaminase, silica gel, silymarin, sodium benzoate, sodium citrate, sodium iodide, sodium nitroprusside, sodium phosphate, sodium phosphate buffer, sodium phosphate dibasic, sodium starch glycolate, span diagnostic kit, starchpowder, talc, tannic acid, tertiary butyl alcohol, topfersreagent, tptz, trifluoroacetic acid, triphenyltetrazolium, tripyridyltriazine, tween, vitamin, wagners reagent, water for hplc, a amylase, a glucosidase

Central Government/Public Sector

TRN :35553355 | 27 Oct, 2025

Tender Value : 0

Kasargode - Kerala

Tender for gem bids for chemicals, bid number gem2025b6756582 dated 06-10-2025 bid document1 61 1 1 petroleum ether, acetonitrile hplc grade, sulphuric acid, potassium sulphate, sodium hydrogen carbonate, sodiumcarbonate, potassium nitrate, ammonium molybdatetetrahydrate, diethyl ether, calcium nitrate tetra hydrate, zinc sulphate, magnesium sulphate heptahydrate, amyloglucosidase, sodium acetate, sodium hydroxidepellets, sodium benzoate, self indicating orange to greensilicagel desiccant beads 3.5mm beads, disodium tartratedihydrate m w 230 08 30g, iron iii chloride hexa hydrate, arecoline hplc standards, arecaidine hplc standardsta9h9a1d2054 50mg, guvacine hplc standards, guvacoline hplc standards, acetone, sodium phosphatemonobasic anhydrous hplc, hplc standard sorbitol dsorbitol s1876 500mg p, petroleum jelly, pepsin, podgod kit, invertase, a amylase type, tris buffer, hydrochloric acid, nitrile coated hand gloves, chloroform, folin ciocatens phenol reagent, glacial acetic acid, iodine, glucose sucrose assay kit, magnesium sulphate, edtaferric acid, potassium dihydrogen, boric acid powder, molybdic acid, manganese sulfate, potassium chloride, sodium meta bisulphate, phenol, manganese iisulfatemonohydrate, copper ii sulfate pentahydrate, beaker 250ml, beaker 100 ml, beaker 500 ml, beaker 50 ml, stdflask 10ml class a, test tube 50ml, centrifuge tube 5ml, centrifuge tube 50 ml autoclaveable, centrifuge tube15ml, spatula big ss, spatula ss small, cryogenic vialsscrew type 10ml, round bottom flask 25ml, standardflask 5ml class a, pipette tip 1ml, pipette tip 200ul, nylonsyringe filter non sterile 0.45 25 mm, ptfe syringe filternon sterile 0.45 mm 25 mm, nylon syringe filter sterile0.45 25 mm, capacity 3ml glass syringe luer lock tip style, ipa hplc grade 2.5l, non sterilized centrifuge tarsonstube conical bottom 15 ml, non sterilized centrifugetarsons tube conical bottom 50 ml, centrifuge tube boxfor 15 ml tubes 36 places, centrifuge tube box for 50 mltubes 16 places, plastic tray for laboratory large sizerectangular, nylon 66 membrane filter 0.2mm 47mm

Central Government/Public Sector

TRN :35560461 | 28 Oct, 2025

Tender Value : 9.36 Lacs

Ramgarh - Jharkhand

Tender for gem bids for drugs, sitagliptin 50 mg tab metformin 1000 mg tab sodium valproate 200 mg tab sodium bicarbonate1000 mg tab sodium hyaluronate 01 eye drops ed sodium hypochlorite bleach sodium lactateringer lactate fluid solifenacin 10 mg tab sypalpha amylase pepsin digestive enzyme syp ironwith vitamin b 12 and folic acid bottle of 200ml syp syp liver tonic liv52 syp paracetamol 162 mgibuprofen 100 mg 60 ml syp periactincyproheptadine syp potassium citrate citric acid100 ml bottle syp tricholine citrate sorbitol tacrolimus 01 ointment tacrolimus 03 oint tadalafil 20mg tab tamsulin 04 mg dutasteride 5mg tab urimax d tab taurine 500mg acetylcystine150mg telmisartan 40 amlodipine 5 mg tab tendocare tab tenofovir alafenamide 25 mg tab thiocolchicoside 8 mg myoril tab thyroxin 125mcg thyroxin 125 mcg tab thyroxin 625 mcg thyroxin88 mcg tab thyroxine 375 mg tab thyroxine 50mcg tab thyroxine 75 mcg tab timolol maleateeye drop 05 bott of 5 ml tiotropium bromide 9 mcg120 metered dosesunit inhalerotacap tolperisonesr 150 mg tab tolvaptan 15 mg tab torsemide 10spironolactone 50 mg tab torsemide 20 mg tab torsemide 5 mg spironolactone 25 mg tab torsemide 5 mg tab tramadol 50 mg paracetamoltab tramadol 50 mg cap trihexyphenidyl 2mg tab trimetazidine mr 35 mg flavedon mr tab trypsinand chymotrypsin 61 100000 au enteric coatedchymoral fort tab trypsin chymotrypsindiclofenac chymoral forte d tab urea cream 50gm ursodexycholic acid 300mg tab udiliv vitamine evion 200mg cap volini gel tube of 50 gm linseed bid number gem2025b6725569 dated 07-10-2025 bid document1 83 1 1 oil diclofenacmethyl salicylate menthol gel, warfarin 1mg tab, warfarin 5 mg tab, xylometazoline hydrochloride 01 nasel spray, lotpurified water glycerin hydrogenated polyiobutene ceteaylalcho100ml, lotion contains decapeptide 1 mg isopropylalcohal myristate and glycol base of 5 ml, aloevera cetylachohol methylparaben squalene and vit e acetate tube of150 gm, lot alovera 10 calamine 8 liquid paraffin 10 100ml bott, amlodipine 5mg metoprolol 25mg tab, cilnidipine 10 mg metoprolol 50 mg tab, claviclesupport medium size, crp kit span, dicyclomin 10mg tab, dns fluid bott of 500 ml, donepezil 5mgmemantine 10mg tab, ear drop chloramphenicol 5wv clotrimazole 1 wv betamethasone 025 wvlignocaine hcl 2 wv in bottle of 5 ml, ed atropine, ed hydroxy propyl methylcellulose dextranglycerin polysorbate 80 with polyquadpreservative eyemist tear naturale forte, edolopatadineketorolac, eye drop tobramycin03 5 ml, eye oint ciprofloxacin, gentamycin eyeear drop, hydrogen peroxyde solution, hydroxy methylcellulose eye gel, ibuprofen 100mg5mg bott of 50ml syp, inj pheniramine 2275 mgml, inj adrenaline11000 1 ml, inj atropine 06 mg 1 ml, injdexamethasone 2 ml vial, inj dextrose 25, injdicyclomine 20 mg, inj lignocaine 2 with adrenaline, inj neurobion, inj methylcobalamine mecovit 500mg, isotonic glusose saline, ivermectin 12mg tab, lansoprazole 15 mg cap, lansoprazole 30 mg cap, leishman stain solution ready to use, lidocaine 4ww ww anometrogyl ointment, lorazepam 2 mg tab, neomycin beclometahsone clotrimazole ed eardrops, normal saline fluid sodium chloride 09 500ml, pcm 250 mg caffein 100 mg ergotamine 1mgp 25vasograin tab, pheniramine maleat 25mg tab, secnidazole 500 mg tab, syp iron folic acid, syplactulose 200 ml, syp salbutamol 100ml, telmisartan 20mg tab, telmisartan 40 mgchlorthalidone 125 mg tab, thiamine 100mg tab, tofacitinib 11 mg tab, tranexamic acid 500 mgmefenamic 250 mg tab, vitamin a cap, voglibose03mg tab, zinc tab, alpha lipoic acid 100 mg tab, bisacodyl 10 mg tab, tab cold plus, inj lignocaine 2without adrenalinesitagliptin 50 mg tab metformin 1000 mg tab, sodiumvalproate 200 mg tab, sodium bicarbonate 1000 mgtab, sodium hyaluronate 01 eye drops ed, sodiumhypochlorite bleach, sodium lactate ringerlactate fluid, solifenacin 10 mg tab, syp alphaamylase pepsin digestive enzyme, syp iron withvitamin b 12 and folic acid bottle of 200ml syp, sypliver tonic liv52, syp paracetamol 162 mg ibuprofen100 mg 60 ml, syp periactin cyproheptadine, syppotassium citrate citric acid 100 ml bottle, syptricholine citrate sorbitol, tacrolimus 01ointment, tacrolimus 03 oint, tadalafil 20mg tab, tamsulin 04 mg dutasteride 5 mg tab urimax d tab, taurine 500mg acetylcystine 150mg, telmisartan 40amlodipine 5 mg tab, tendocare tab, tenofoviralafenamide 25 mg tab, thiocolchicoside 8 mg myoriltab, thyroxin 125mcg, thyroxin 125 mcg tab, thyroxin 625 mcg, thyroxin 88 mcg tab, thyroxine375 mg tab, thyroxine 50 mcg tab, thyroxine 75 mcgtab, timolol maleate eye drop 05 bott of 5 ml, tiotropium bromide 9 mcg 120 metered dosesunit

Central Government/Public Sector

TRN :35476318 | 31 Oct, 2025

Tender Value : 0

Multi Location - Multi State

Tender for supply of serum urea reagent -erba xl system pack, serum creatinine reagent, serum cholesterol reagent, serum hdl cholesterol reagent, serum amylase reagent, serum total bilirubin reagent, serum direct bilirubin reagent, serum calcium reagent, serum uric acid reagent, serum alkaline phospatase reagent, erba auto wash reagent, serum triglycerides reagent, serum total protein reagent, serum albumin reagent, serum ck mb reagent.

Related Searched Keywords : amylase

List of amylase Tenders

Tender for supply of pancreatin mini microspheres equivalent pancreatin mini microspheres equivalent to pancreatin 300 mg with declared enzyme activity amylase 18000 peu/u, lipase 25000 peu/u & protease 1000 peu/u creon 25000..

Get amylase Tender Alert...

Related Searched Keywords : amylase

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us