Indian Tenders Tender information of India
Global Tenders International Tender information
Projects Project information of India
Tender Awarded Tender awarded information
Sub-Contractor Vendor information of India
Pay Online
Register now
Login
Contact Info All India : 9276083333 / 9274315555 South India : 9274315555

Filters

List of nainital-uttaranchal- Tenders

List of latest nainital-uttaranchal- Tenders in Indian Tenders. Click on any nainital-uttaranchal- Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for nainital-uttaranchal- Tenders.

All-Tenders (84)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

State Government

TRN :35626787 | 06 Nov, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for construction of interlocking tile internal road of parwati kunj-i udaypuri chopra in ramnagar constituency at district nainital under state sector

State Government

TRN :35626839 | 06 Nov, 2025

Tender Value : 2.10 Crore

Nainital - Uttaranchal

Tender for image guided system with radio frequency generator

Central Government/Public Sector

TRN :35627449 | 23 Oct, 2025

Tender Value : 27.0 Thousand

Nainital - Uttaranchal

Tender for gem bids for short term cab & taxi hiring services - hatchback; local;80kms x 10hrs, short term cab & taxi hiring services -sedan; local; 80kms x 10hrs, short term cab & taxi hiringservices - premium sedan; local; 80kms x 10hrs, shortterm cab & taxi hiring services - suv; local; 80kms x10hrs, short term cab & taxi hiring services - premiumsuv; local; 80kms x 10hrs, short term cab & taxi hiringservices - hatchback; outstation; 500kms x 14hrs, shortterm cab & taxi hiring services - sedan; outstation;500kms x 14hrs, short term cab & taxi hiring services -premium sedan; outstation; 500kms x 14hrs, short termcab & taxi hiring services - suv; outstation; 500kms x14hrs, short term cab & taxi hiring services - premiumsuv; outstation; 500kms x 14hrs /

State Government

TRN :35609360 | 22 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for respirable dust sampler as per is 5182 q3

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

State Government

TRN :35611454 | 28 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for continuous ambient air quality monitoring system - sensorbased q3 *

Central Government/Public Sector

TRN :35611797 | 03 Nov, 2025

Tender Value : 26.00 Lacs

Nainital - Uttaranchal

Tender for gem bids for rainbow trout larval feed 0 point 3 mm pallet, rainbowtrout larval feed 0 point 5 mm pallet, rainbow trout larvalfeed 0 point 8 mm pallet, rainbow trout nursery feed 1point 2 mm floating pallet, rainbow trout grower feed 1point 8 mm floating pallet, rainbow trout grower feed 3mm floating pallet, rainbow trout grower feed 6 mmfloating pallet, rainbow trout nursery feed 0 point 8 mmpallet, rainbow trout early grower feed 1 point 2 mmfloating pallet, rainbow trout early grower feed 1 point 8mm floating pallet, carp feed 4 mm floating, plasticinsulated ice box, oxygen cylinder, weighing balance, drag net, hand net, hapa, polythene bag, silpoline, fishwader

State Government

TRN :35612351 | 03 Nov, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for nfion dryer

Central Government/Public Sector

TRN :35614048 | 23 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for upgradation and modernisation of grocery display shed aturc

State Government

TRN :35614829 | 21 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for laboratory desiccator (v2) (q3)

1
2
3
4
5
6
7
8
9

Related Locations of : Uttaranchal

Get Nainital Tender Alert...

Related Locations of : Uttaranchal

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

Copyright ©2018 - Thetenders.com.