Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
City Tenders
»
Nainital-Uttaranchal-
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of nainital-uttaranchal- Tenders

List of latest nainital-uttaranchal- Tenders in Indian Tenders. Click on any nainital-uttaranchal- Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for nainital-uttaranchal- Tenders.

Advance Search
  • All-Tenders (84)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
21 Construction
image image
State Government
TRN :35626787 |  06 Nov, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for construction of interlocking tile internal road of parwati kunj-i udaypuri chopra in ramnagar constituency at district nainital under state sector
  • View Tender
  • Document
  • Bid Support
22 Health Services And Equipments
image image
State Government
TRN :35626839 |  06 Nov, 2025
Tender Value : 2.10 Crore
 Nainital - Uttaranchal
Tender for image guided system with radio frequency generator
  • View Tender
  • Document
  • Bid Support
23 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35627449 |  23 Oct, 2025
Tender Value : 27.0 Thousand
 Nainital - Uttaranchal
Tender for gem bids for short term cab & taxi hiring services - hatchback; local;80kms x 10hrs, short term cab & taxi hiring services -sedan; local; 80kms x 10hrs, short term cab & taxi hiringservices - premium sedan; local; 80kms x 10hrs, shortterm cab & taxi hiring services - suv; local; 80kms x10hrs, short term cab & taxi hiring services - premiumsuv; local; 80kms x 10hrs, short term cab & taxi hiringservices - hatchback; outstation; 500kms x 14hrs, shortterm cab & taxi hiring services - sedan; outstation;500kms x 14hrs, short term cab & taxi hiring services -premium sedan; outstation; 500kms x 14hrs, short termcab & taxi hiring services - suv; outstation; 500kms x14hrs, short term cab & taxi hiring services - premiumsuv; outstation; 500kms x 14hrs /
  • View Tender
  • Document
  • Bid Support
24 Education And Research Institutes
image image
State Government
TRN :35609360 |  22 Oct, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for gem bids for respirable dust sampler as per is 5182 q3
  • View Tender
  • Document
  • Bid Support
25 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
26 Education And Research Institutes
image image
State Government
TRN :35611454 |  28 Oct, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for gem bids for continuous ambient air quality monitoring system - sensorbased q3 *
  • View Tender
  • Document
  • Bid Support
27 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35611797 |  03 Nov, 2025
Tender Value : 26.00 Lacs
 Nainital - Uttaranchal
Tender for gem bids for rainbow trout larval feed 0 point 3 mm pallet, rainbowtrout larval feed 0 point 5 mm pallet, rainbow trout larvalfeed 0 point 8 mm pallet, rainbow trout nursery feed 1point 2 mm floating pallet, rainbow trout grower feed 1point 8 mm floating pallet, rainbow trout grower feed 3mm floating pallet, rainbow trout grower feed 6 mmfloating pallet, rainbow trout nursery feed 0 point 8 mmpallet, rainbow trout early grower feed 1 point 2 mmfloating pallet, rainbow trout early grower feed 1 point 8mm floating pallet, carp feed 4 mm floating, plasticinsulated ice box, oxygen cylinder, weighing balance, drag net, hand net, hapa, polythene bag, silpoline, fishwader
  • View Tender
  • Document
  • Bid Support
28 Education And Research Institutes
image image
State Government
TRN :35612351 |  03 Nov, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for gem bids for nfion dryer
  • View Tender
  • Document
  • Bid Support
29 Security Services
image image
Central Government/Public Sector
TRN :35614048 |  23 Oct, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for gem bids for upgradation and modernisation of grocery display shed aturc
  • View Tender
  • Document
  • Bid Support
30 Education And Research Institutes
image image
State Government
TRN :35614829 |  21 Oct, 2025
Tender Value : 0
 Nainital - Uttaranchal
Tender for gem bids for laboratory desiccator (v2) (q3)
  • View Tender
  • Document
  • Bid Support
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • 7
  • 8
  • 9
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Related Locations of : Uttaranchal
  • Gopeshwar Tenders ,
  • Rudraprayag Tenders ,
  • Pauri Garhwal Tenders ,
  • Dehradune Tenders ,
  • Dehradun Tenders ,
  • Haldwani Tenders ,
  • Almora Tenders ,
  • Tehri Garhwal Tenders ,
  • Tharali Tenders ,
  • Kotdwara Tenders

Get Nainital Tender Alert...

109736

Related Locations of : Uttaranchal

  • Construction Works Tenders In Kolkata
  • Earth Filing Tenders In Kharagpur
  • Piling Tenders In Cochin
  • Irrigation Work Tenders In Bikaner
  • Renovation Work Tenders In Hyderabad
  • Interlock Paver Tenders In New Delhi
  • Civil Works Tenders In Thrissur
  • Drainage Tenders In Angul
  • Civil Engineering Service Tenders In Nagpur
  • Excavation Tenders In Aurangabad(mh)

Read More


Tender Document

943017

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Bore Work Tenders
  • Subways Tenders
  • Canal Works Tenders
  • Check Dam Tenders
  • Desalting Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.in / ceo@thetenders.in

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App