Liasoning Service

277602

Liasoning Service

Warm Greetings from www.thetenders.com, the fastest growing tender information portal in India.

Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5

TRN :35610475
Central Government And Public Sector / Education And Research Institutes
Nainital - Uttaranchal

INDIAN Instructions for obtaining this information:
  1. If you are a registered member, please login in the members area with your user id and password.
  2. If you are not a registered member, then first register for the services.
  3. If you don’t want to register, but want to download only this project information, then fill in the form.
  4. Email id and mobile should be correct. www.thetenders.com will not be responsible for non receipt of the desired information at your end owing to wrong email id and mobile number.
  5. Upon filling this form follow the next instructions.
  6. You will receive the information and documents on the email id provided by you.
  7. In case of any query please call us on +91 92760 83333
INDIAN - Liason

Why www.thetenders.com ?

  • Fastest growing tender information portal in India
  • User friendly tender web portal with multiple search criteria
  • Reliable and quick tender information services
  • Reduces time, cost and man power required for tender cycle
  • Tenders information across India and Globe
  • Tenders categoried in various groups
  • Team, sprawling over entire Geography, scans various tenders and uploads them on our portal
  • Comprehensive and Sophisticated software to search online tenders
  • Search features by Product Keywords, Industries, States & Regions, Price, Organisation & Sectors etc.
  • Choose categories as per your choice
  • Daily alerts on emails about tenders of your category
  • Non English Tenders translated into English
  • 24 x 6 customer support with E-tendering support
  • Scanned copies of tender documents
  • Tenders from Government, Semi Government, Corporate Sector, Private Sector, PSUs, NGOs, state, city and local bodies
  • Download available tender documents.
  • Technical support for online and offline tenders including e-bidding, e-auction etc.
  • No hidden Cost / No Additional Charges / Quick service activation
  • Bid Form collection support
  • Bid Form filling support
  • Bid Form submission support
  • Provide SEO benefit for you site*
  • Available upcoming projects and Market research journals absolutely free.
  • Free 5 page website designing and hosting *
  • Provides platform to advertise your products daily through emails and reach the customer inbox directly. *
  • Tenders from newspapers
  • Tenders from websites

Set Tender Alert

Activate daily alerts to know the tenders available of your work.

Get alerts

Bidding Support

Ask experts, how to fill bid forms, submit bids, participate in bids.

Get in touch

GeM Registration

Looking for GeM Registration? Get in touch with us and we will do the needful.

Registration

Digital Certificate

Get DSC for e-Tendering, e-Auction, e-bidding, Corporations / Associations / Others Tenders

Purchase now

Tender Awards

Want to know who's got the tender and are looking for subcontracting?

Connect now

Projects

Government and other private players, Real-time Updates of Project Information

Get info

International Tenders

We almost cover all the regions and countries across the world. Click to take your business to new heights.

Start now

Web Design

Get the Best Offers & Deals, expertise in developing static websites, dynamic websites and e-commerce.

Design now

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us

W B


Copyright ©2018 - Thetenders.com.