Filters

List of oxygen-cell Tenders

List of latest oxygen-cell Tenders in Indian Tenders. Click on any oxygen-cell Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for oxygen-cell Tenders.

All-Tenders (8)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35718192 | 17 Nov, 2025

Tender Value : 0

Hyderabad - Telangana

Tender for gem bids for oct catheter, ffr and dfr optical sensor bassed wire toassess arterial pressure, eto cartridge 40 gm compatiblewith sambion kill kinetics, tab cilostazole 100 mg, tabvericiguat 10 mg, tab vericiguat 5 mg, tab vericiguat 2point 5 mg, primrose oil cap primosa, laryngoscope cell1point 5 v diameter 13 mm and length 51 mm for type d, tab metalazone 5 mg, inj phenytoin sodium 100 mg, tabserratiopeptidase 5 mg, sodium valporate cr 300 mg tab, isopropanol and benzalkonium chloride skin antisepticcutasept, tab divalproex sod er 1000mg, tab lithiumcarbonate cr 400 mg, cap gabapentin 100 mg, 26gcannula with injection port and luer lock, sodium valproateand valproic acid tab 500mg chrono cr, amitriptyline10mg, inj mephentermine 30mg per ml 10ml, tube endo-tracheal nasal size 2 point0 without cuff, tube endo-tracheal nasal size 2 point 5 without cuff, disposableventilator tubing compatible for hfo ventilator, doublelumen pur umbilical catheter 4f, pigtail drainage catheter6 and 8f with stiffening cannula and trocar, microvacutainer biochemistry, nasal cannula for oxygenadministration for infant 1000 and 2500gm, 3 percentsaline bott of 100ml, microvaccutainer haematology, sterile adhesive conforming soft nonwoven dressingabsorbent pad 9 cmx25cm, sterile adhesive conformingsoft nonwoven dressing absorbent pad 6 cmx8 cm, castpadding 10cmx 3m 10 percent variation in dimesnsionacceptable, cast padding 15cmx 3m 10 percent variation indimesnsion acceptable, drill bit 2 point 7 mm, distalfemoral supracondylar nail titanium 9mm and 11mm x 300-360mm two matching, expert retrograde antegrade formalnail system with dia 9point 0 to 12point 0 mm, 3 point 5mm lcp medial distal tibial locking plate titanium 4 and14hole right left, disposable batteries compatible withlinvatec surgical saw system, n acetyl cysteine 200 mgper ml 5 ml amopule, tab desmopressin 0 point 1 mg, injtirofiban 5mg per 100 ml, inj fondaparinux 2 point 5 mg, inj diltiazem 5 mg per ml, amino acid preparation iv bott of200 ml, intralipid 20 percent in bottle of 100 ml, t -piece inthree sizes extension line, bone marrow aspiration needle, extension line with 3 way stopcock 10 cm, disposablefeeding bags size 1 l or more, glycerin glycerol 500 ml, injetomidate 2mg per ml 10 ml vial, cap sacchomycesboullardi 250 mg, tab ethambutol 1200 mg, inj milrinone10mg per 10ml, lactic acid bacillus sachet, rivastigmine5 sq cm patch delivering 4 point 6mg 24hr transdermal of30 patches, tab escitalopram 5 mg, carboprosttropmethamine 250mcg per ml 1 ml, clotrimazole andclindamycin vaginal pessary 6 tab kit, inj betamethasone 4mg 1 ml, pap smear, chlorhexadine gluconate solutionequivalent to 4 percent isopropanol 10 percent ethoxylated, cap doxepin hcl 75 mg, cap memantine 5 mg, tabaripiprazole 15 mg, tab clozapine 25 mg, tabdesvenlafaxine 50 mg, tab atomoxetine 10 mg, tabtrazodone 50 mg, tab venlafaxine 37 point 5 mg, tabamisulpride 200 mg, tab quetiapine 25 mg, micro gen d125 wet wipes, doxylamine succinate 10 mg usp andpyridoxine hydrochloride 10 mg ip tab doxinate, clindamycin 300 mg cap, bisacodyl 5 mg taboct catheter, ffr/dfr optical sensor bassed wireto assess arterial pressure with frequencyresponse of 0-25 hz, eto cartridge 40 gm compatible //bid details2 / 63

Central Government/Public Sector

TRN :35706176 | 13 Nov, 2025

Tender Value : 2.00 Crore

Chandigarh Ut - Chandigarh

Tender for gem bids for mechanical ventilator, disposable inbuilt dual heater wireand humidifier chamber ventilator circuit infant size, disposable inbuilt dual heater wire and humidifier chamberventilator circuit pediatric size, niv mask non vented infant, niv mask non vented pediatric, niv mask vented infant, niv mask vented pediatric, disposable flow sensors ifproximal flow sensor is required, heated humidifier, pediatric test lung, oxygen cell, reusable expiratory valveor cassettee, disposable expiratory bacterial or viral filter, disposable nebulizer kit, etco2 adaptor, high flow nasalcannula infant, high flow nasal cannula pediatric, cmc forfirst year, cmc for second year, cmc for third year, cmcfor fourth year, cmc for fifth year, cmc for sixth year, cmc for seventh year, cmc for eight year

Central Government/Public Sector

TRN :35691573 | 01 Nov, 2025

Tender Value : 0

Alwar - Rajasthan

Tender for gem bids for pulse, pulse oximeter, rechargeble cell aa, oxygenflowmeter, bp moniter mercury, vital bp cuff, vital bp cuff with bladder

State Government

TRN :35682645 | 11 Nov, 2025

Tender Value : 0

Trivandrum - Kerala

Tender for gem bids for spares, main board for agilia sp syringe pump, forcesensor for agilia sp syringe pump, battery foragilia sp syringe pump, display for agilia sp syringepump, keypad for agilia sp syringe pump, flow sensorcable for sle 4000 to 5000, flow sensor for sle 5000 hfventilator, oxygen cell for sle 4000 to 5000, powersupply board for injectomat agilia syringe pump, disengagement lever switch for agilia forinjectomat agilia syringe pump, force sensor withcable for injectomat agilia syringe pump, keypadcover kit, display board for injectomat agiliasyringe pump, rechargable batteery pack 6 v forsyringe pump injectomat agilia

State Government

TRN :35653275 | 05 Nov, 2025

Tender Value : 0

Latur - Maharashtra

Tender for supply medicine, surgical and chemical kits items - tab.amitriptyllin 25mg tab.amlodipin 5mg cap.amoxycillin 500mg tab.amoxy 500+clavulanic acid 125 tab.ascorbic acid 100mg tab.aspirin 75mg tab.atenelol 50mg tab.atrovastatin 10mg tab.azithromycin 500mg tab.calcium lactate +vit d3 tab. carbamazepine 200mg tab.cetrizine 10mg tab. ciprofloxacin 500mg tab.clonazepam 0.5 mg tab.diclofenac sodium 50mg cap.doxycyllin 100mg tab.escitalopram 10mg tab.fluconazole 150mg tab.frusemide 40mg cap.iron & folic acid (ferofolla) tab. itroconazole 100mg tab. ivermectine 12mg tab. isorbitrate 10mg tab. labetalol 100mg tab. lorazepam 2mg tab.metformin 500mg tab.metronidazole 400mg tab.misoprostal 200mcg cap. multivitamin tab. nefidepin 10mg tab.norflox 400mg tab.olenzapine 5mg tab.pantoprazole 40 mg tab.paracetamol 500mg tab.phenytoin sodium 100mg tab.prednisolone 5mg tab. sertaline 100mg tab.salbutamol 4mg tab.sodium valproate 200mg tab.trihexyphenidyl +trifluperazine tab.clopidogrel 75mg tab.glimipride 1gm (inj. & iv ) adrenaline bitartrate inj 1 mg/ml adenosine inj. amikacin inj 500mg 2ml amiodarone injection amoxycilline with clavulanic acid inj 1.2 gm anti rabies serum 1500iu inj anti rh d inj 300 mcg anti rabies vaccine 1ml atracurium 2.5ml asyclovir 500mg inj. atropine inj 1ml inj. asvs bupivacaine + dextrose 4ml butrophenol inj buprenorphine inj caffiene inj. calcium gluconate 10ml carboprost 250mcg cefotaxime 1gm injection clindamycin 600mg injection colisthimithate 10lakh iu inj. dexamethazone inj 2ml dexmedetomidine inj deriphylline 2ml inj. diclofenac sodium 1 ml injection diclofenac sodium 3 ml injection diltiazem injection diazipam inj dobutamine 5ml inj dopamine 5ml inj. drotavarine 40mg frusemide inj 2ml gentamycin inj glycopyrrolate inj 1ml haloperidol inj. heparin 25000iu inj. hyluronidase 1500iu inj. hydrocortisone sodium succinate inj 100mg hepamerz inj. human actrapid insuline 10ml iron sucrose 5ml ketamine inj. labetalol 20mg, 4ml inj low molucular heparine 0.6ml lignocaine hydrochloride 2% 30ml lignocaine with adrenaline(1:80000) 30ml levetiracetam 500mg inj lorazepam inj loxicard 4% 50ml inj. magnesium sulphate inj 2 ml menadione sodium bisulphite inj 1ml (vit k) mephentermine inj 10ml meropenum 1gm inj inj. methyl prednisolone 500mg(iv use) midazolam 10ml mucinac (n-acetyl cysteine) neostigmine inj 1ml noradrenaline 2ml inj. nitroglycerin octriotide 100mg inj ondonsetron 2mg inj. oxytocin 5iu/ml 1ml pantoprazole 40mg inj pentazocine lactate inj 1ml inj. phenobarbotone phenaramine maleate inj 2ml phenytoine sodium inj 2ml piperacillin sodium 4gm + tazobactam inj potassium chloride inj 10ml pralidoxime chloride inj 500gm promethazine hcl inj propofol 10ml inj. ropivcaine 20ml. rituximab 500mg/50ml injection sodium bicarbonate 10ml sodium valporate inj. streptokinase 15lac inj. succinyl choline tetanus immunoglobuline 500iu inj. tetanus toxoid 5ml tetanus toxide 0.5ml tramadol 50mg inj. tranexamic acid inj thiamine inj. valenthamide bromide inj vancomycine 1gm inj. vecuronium 4mg inj. iv human immunoglobulin 5%, 100ml iv human albumin 20% hepatetis b immunoglobulin 100iu iv amino acid 500ml iv fat emulsion 250ml iv sodium chloride 0.9% 500ml iv sodium chloride 0.9% 100ml iv ringer lactate 500ml iv dextrose with sodium chloride 500ml iv ciprofloxacin 100ml iv metronidazole 100ml iv manitol 100ml iv linezolid 200mg/100ml inj. suggamadex(inj. reversal) iv glycine irrigation solutin 3liter iv sodium chloride solution 3liter jar iv livofloxacin 500mg/100ml iv paracetamol 100ml (liquid and orals)amoxy+potacium clavunic oral susp. 30ml antacid syrup betadine povidone iodine 5% solution 500ml budesunide respulses 0.5mg 2ml calamine lotion calcium phospate + vitd3 syp. 200ml carboxymethyl cellulose eye drop 10ml cetrizine syrup 30ml ciprofloxacin + dexamethazone e/d ciprofloxacin eye/ ear drop clobetasol ointment 30gm clotrimazole cream 15gm dinoprostone gel 30gm desflurane liquid 240 flurbiprofen eye drop 5ml formaldehyde solition 400ml glycerin ip hydrogen peroxide 100ml hydrogen peroxide+ silver nitrate 1 ltr. (sanishield) lignocaine jelly 2% 30gm liquid parafine 500ml liquid sevoflurane 250ml lulliconazole ointment magnesium sulphate 400gm miconazole nitrate cream 2% 15gm moxifloxacin eye drop 5ml multivitamin syrup paediatric o-d spirit 1000ml ondensetron oral solution paracetamol syrup 60ml polymeric biagonide 1000ml (sanihygen) potasium permagnate (kmno4) powder povidone iodine ointment 15gm sanidex opa 5 ltr jar saniquid -m 20 handwash saniquid-p/ benzalconium 500ml saniscrum -m silver sulphadiazine cream sodium hypochlorite 200ml sodium hypochlorite 5ltr. jar (medichlore) surgical spirit 500ml wax solvant ear drop 5ml zinc sulphate syrup 60ml proparacain eye drop 0.5% 5ml tropicamide + phenylephrine eye drop tropicamide eye drop 5ml silver sulphadiazine ointment 250gm framycetin sulphate cream 30gm surfuctant 3ml vial duoline respulses duphilac syp. (suture, sergical and dressing material)absorbent cotton wool i.p packet of 500 gm net bandage cloth as per schedule fii of drugs and cosmetics act 1940 than of 100cm x 20 mtrs. absorbent gauze cloth as per schedule f-ii of drugs and cosmetics act.1940 than of 90cm x 18 mtrs mask triple layer face (disposable) intravenous infusion set adult urine bag 2000 ml disposable catheter foleys self retaining 2 ways size-8fr catheter foleys self retaining 2 ways size-10fr catheter foleys self retaining 2 ways size-12fr catheter foleys self retaining 2 ways size-14fr catheter foleys self retaining 2 ways size-16fr catheter foleys self retaining 2 ways size-18fr disposable insulin syringe u-40/1 ml each disposable syringe sterile with needle 2 ml disposable syringe sterile with needle 5 ml disposable syringe sterile with needle 10 ml disposable syringe sterile with needle 50 ml elastic adhesive bandage with adhesive mass (ip/usp/bp.) weight nlt (not less than) 145 gsm % stretch-not less than 75%, % regain ?not more than 65% size 10 cm x 4 mtrs cannula intra venous with needle in cannula i.p. with injection port, with wings size-18g cannula intra venous with needle in cannula i.p. with injection port, with wings size-20g cannula intra venous with needle in cannula i.p. with injection port, with wings size-22g cannula intra venous with needle in cannula i.p. with injection port, with wings size-24g cannula intra venous with needle in cannula i.p. with injection port, with wings size-26g cannula intra venous with needle in cannula i.p. with injection port, with wings size-23g cannula intra venous with needle in cannula i.p. with injection port, with wings size-27g catheter suction disposable size-8fr catheter suction disposable size-10fr catheter suction disposable size-12fr catheter suction disposable size-14fr catheter suction disposable size-16fr catheter suction disposable size-18fr gloves latex examination size-medium gloves latex examination size-large gloves rubber sterile, powder free isi mark size-6.5 inch gloves rubber sterile, powder free isi mark size-7 inch gloves rubber sterile, powder free isi mark size-7.5 inch plastic gloves disposable ryles tube sterile disposable size-14fr ryles tube sterile disposable size-16fr ryles tube sterile disposable size-18fr sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-3 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-3.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-4 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-4.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-5.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-6.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-7 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-7.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-8 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-8.5 mm id infant feeding tube no. 7 infant feeding tube no. 8 plaster of paris bandages (ready made) size 15 cm x 2.7 m plaster of paris bandages (ready made) size 20 cm x 2.7 m adhesive tape cloth based with porous and hypoallergenic adhesive mass having uniform spiked impression size 10cm x 5mtr mask oxygen (adult) mask oxygen (paediatric) mask nebulizer adult mask nebulizer paediatric diaper adult disposable cap surgeon disposable evacuated tubes k2 edta with double cap 2 ml clot activator double cap non vacuum 4.0 ml (13 mm x 75 mm) evacuated tubes 3.2% buffered sodium citrate with double cap 2 ml tubes non vacuum disposable hiv kit autoclave indicator strip (label) pack of 100 lables (2.5 cm x 6 cm) oxygen nasal cannula adult oxygen nasal cannula neonatal rubber makintosh colour :green,blue, red, thickness-0.4mm, width 110cm. roll of 30 meters i.s.o. certified, isi markwidth cord clamp sterile biomedical waste container red colour 60 ltr. biomedical waste container yellow colour 60 ltr. biomedical waste container blue colour 60 ltr. biomedical waste container black colour 60 ltr. biodegradable bio medical waste bags colour red size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour yellow size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour blue size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour black size 33inch x 36inch 51 micron (per kg) airway plastic latex free size 3 airway plastic latex free size 4 airway plastic latex free size 5 dial flow regulator extension set venous extension line with 3way size-10cm venous extension line with 3way size-25cm venous extension line with 3way size-50cm venous extension line with 3way size-100cm venous extension line with 3way size-150cm j r circuit bain circuit adult ecg electrodes for adult ecg/ultrasonography jelly 250 ml central venous catheter kit size- 7 f x 16 cm type- triple lumen oxygen flow meter with rotameter & humidifier bottle abdominal drain kit 28 abdominal drain kit 30 abdominal drain kit 32 a.v.fistula needle set size 17g x 1 epidural anaesthesia set 16g epidural anaesthesia set 18g blood administration/ transfusion set drape disposable poly plain sheet 100cm x 150cm appron plastic disposable romovac drain set 12 f romovac drain set 14 f romovac drain set 16 f romovac drain set 18 f bactigauze (chlorhexidine gauze dressing) pack of 10 piece size- 10 cm x 10 cm picc line 22 colostomy bag dialyser adult hemodialysis tubing set lma [i gel] 3 lma [i gel] 4 lma [i gel] 5 bone wax (pack of 12 piece) collagen dressing 15cm x 30 cm (per piece) surgicel original 4 in x 8 in (12/box) skin stapler multidirectional 35 wides minivac drain 8 f minivac drain 10 f sideport 15 dg crescent 2.5 mm eye drape 70 cm x 70 cm (pack of 10) keratome blade 2.8 mm (chemical, diagnostic kits) glucose total bilirubin direct bilirubin sgot sgpt alkaline phosphatse total protein albumin urea creatinine total cholesterol triglycerides ldl cholesterol hdl cholesterol uric acid csf protein (microprotein) calcium phosphorus magnesium amylase lipase ckmb ldh ise module reagent na+/k+/cl-/li+ xl multical erba auto wash kit xl auto wash (a/al) erba norm erba path tubing kit pm kit h 360 dil-1 1 x 20 liters h 360 lyes- 3 x 500 ml elite h clean- 4 x 50 ml h-360 control l, n, h h-360 calibrator aspen ds diluent aspen m-6ld lyse aspen m-6fd dye aspen m-6lh lyse aspen m-6ln lyse aspen m-6fn dye aspen probe cleanser hbsag elisa kit (+10) hiv elisa 4 th gen.kit hcv elisa kit vdrl rpr kits (+10) antisera blood grouping kit abd igm (monoclonal) 3 x 10 ml denguecombo rapid test card hbsag rapid test card (antigen detection) (+10) abg cassette/strip calibration gas epoc bgem test card (pack of 25) syringe with needle 3 ml thermal roll 57 mm tsk gel b-thala his g8 filter element g8- thalassemia elution buffer kit hemolysis and wash solution (l) g 8 hemoglobin f & a2 control g 8 hemoglobin f & a2 calibrator ribbon, ebar printer bluing reagent hematoxylin 10x ssc solution, 2 l label, blank, flap, 540 roll lcs reaction buffer concentrate (10x) 10x ez prep solution, 2 l cell conditioning solution, cc1, 2l ultra view universal dab detection kit confirm anti-cd99 mouse mono confirm cytokeratin 20 rabit mono confirm anti-desmin (de-r-11) pab ventana anti-e cadherin (36) confirm cytokeratin 7 rabbit mono confirm anti-s100 (4c4.9) primary antibo ventana anti-p63 (4a4) mouse mono matrix gel card ahg (144 test) matrix liss solution (500 ml) uniplastin for prothromine time itinr cuvette formalin solution (37 to 40 %) xylene (sulpher free) micropipette tips 200 ul ethanol absolute alcohol paraffin wax confirm anti- pr (1 e2) confirm anti- er (sp1) pathway anti-her2/neu (4b5) rabbit mono confirm anti-ki-67 (30-9) rabbit monoclo confirm anti-p67 (d0-7) primary antibody lohexol dye 100ml

Central Government/Public Sector

TRN :35630555 | 05 Nov, 2025

Tender Value : 0

Chandigarh Ut - Chandigarh

Tender for gem bids for icu ventilator high end, humidifier servocontrolled with digital monitoring of inspired gastemperature with heating wire, reusablehumidifier chamber, oxygen cell or sensor, trolley for each ventilator with circuit holdingarm, air and oxygen hose, disposable breathingcircuit adult, disposable breathing circuitpediatric, reusable and autoclavable siliconbreathing circuit adult, reusable andautoclavable silicon breathing circuit pediatric, niv mask reusable small, niv mask reusable medium, niv mask reusable large, reusable flow sensoradult, reusable flow sensor neonatal, disposableflow sensor adult, disposable flow sensorneonatal, disposable hme filter adult, disposablehme filter pediatric, exhalation valve orexpiratory cassette reusable autoclavable, exhalation valve or expiratory cassette disposable, disposable t type nebulizer kit, cmc first year, cmc second year, cmc third year, cmc fourth year, cmc fifth year, cmc sixth year, cmc seventh year, cmc eighth year

Central Government/Public Sector

TRN :35631048 | 05 Nov, 2025

Tender Value : 21.34 Lacs

Nainital - Uttaranchal

Tender for gem bids for anti rainbow trout oncorhynchus mykiss atlantic salmonsalmo salar igm monoclonal antibody lyophilized proteinprepared from bovine free tmb elisa substratesolutionsturbo250 ml per pack bovine serum albuminbsa protease free fatty acid free ph 7 0 50 grams per pack goat anti mouse igg h l secondary antibody hrpconjugated lyophilized polyclonal 2ml per vial hydroxylamine hydrochloride hi ar acs n 1 naphthylethylenediamine dihydrochloride hi ar acs nedd 2phenoxyethanol vanadium iii chloride sodium nitrite sodium nitrate hi lr hydrochloric acid concentrated sodium hypochlorite hi ar acs 4 w v solution ezassaytbars estimation kit for lipid peroxidation 100 reactions ezassaytm reactive oxygen species assay kit frap 200tests agarose low melting field test kit dneasy bloodand tissue kit 50 50 dneasy mini spin columns proteinasek buffers collection tubes 2 ml hematoxylin solution500ml eosin y solution 0 5 alcoholic 500ml histosec 60pastilles without dmso oxolinic acid iodophor chloramine t trihydrate potassium permanganate bhuvision soil nutrient analysis code hg bsna 100 test clearserological pipette 10ml amber glass vials ermamicrotome blades 1 2 propanediol 2 5l erlenmeyerconical flask multi port hplc cap micropipette weigert s iron hematoxylin kit 2x500ml eosin y 5g alcianblue 8gx 10g d p x 100ml paraplast plus 1kg 30acrylamide bis solution 29 1 l thick blot filter paper precut prestained protein ladder methanol glycerol biotin dsorbitol g418 disulfate salt potassium phosphate dibasic potassium phosphate monobasic ptriex 4 neo dnanovagen amicon ultra centrifugal filter 10 kda mwco ampicillin sodium salt imidazole dmso protease andphosphatase inhibitor cocktail tmb enhanced one bid number gem2025b6792045 dated 15-10-2025 bid document1 93 0 0 component hrp membrane substrate, 3 3diaminobenzidine, ammonium persulfate, cobalt iichloride, yepd broth granulated 500g, ypd yepd growthagar 500g, ypd yepd growth medium, yeast nitrogenbase ynb w ammonium sulphate 100g, peptone 500g, yeast extract powder, l histidine, dextrose anhydrous hiar acs, l glutamic acid, l methionine, l lysine hi lr, lleucine, l isoleucine, 10x tris glycine sds gel runningbuffer, 2 5x tris sds buffer ph 8 8, 5x tris sds buffer ph 68, 10x transfer buffer, 5x laemmli buffer, 50x tae, rnaisolation, sedgewick rafter counting chamber cell, borosilicate bod bottles, borosilicate dissolved oxygenbottles, uniflo 13mm 0 2 pes s 100 pk, uniflo 13mm 045 pes s 100 pk, uniflo 25mm 0 45 pes s 45 pk, uniflo25mm 0 2 pes s 45 pk, single tubes pcr 0 2 ml transparentwith attached flat cap, microcentrifuge tubes pp 0 5 ml withattached cap with lid closure, microcentrifuge tubes pp 1 5ml with attached cap with lid closure, microcentrifuge tubespp 2 0 ml with attached cap with lid closure, microcentrifuge tubes pp 5 ml transparent, mueller hintonagar granulated 500g, mueller hinton broth 500g, glucose yeast extract agar 500g, glucose yeast extractacetate broth 500g, agar granulated bacteriological grade500g, nutrient agar granulated, nutrient broth granulated, d glucose anhydrous, sodium chloride, xylene forhistopathology 2 5l, resazurin sodium salt 5g, z 2 cl osu100g, mtt 1g, n phenyl 1 naphthylamine 500g, propidium iodide, wizard genomic dna purification kit 100isolations x 300ul, wizard sv gel and pcr cleanup system50 prep, hepes molecular biology grade free acid 100g, disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg, petridish, centrifuge tube conical bottom with lid, selfstanding centrifuge tube with lid, cryovial with externalthreaded self standing sterile, cryo box pp, rack for microtube l, rack for micro tube, universal tube rack pp, universal tube rack, 20c mini cooler with gel filled cover, 0c mini cooler with nontoxic gel, agar powderbacteriological grade, mueller hinton agar, mueller hintonbroth, tryptone soya broth soyabean casein digestmedium, tryptone soya agar casein soyabean digest agarsoyabean casein digest agar, steriswift disinfectant wipes, polyethylene glycol mw 6000, sterile cotton swab, 2 10ulaerosol barrier gentip, 20 200ul aerosol barrier gentip, 100 1000ul aerosol barrier gentip, wrappup alluminiumfoils, biosoft tissue, kimwipes, kimberly clark, ecosafedisinfectant, centrifuge tube, petri dish, syringe

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Related Searched Keywords : oxygen cell

List of oxygen-cell Tenders

Tender for gem bids for pulse, pulse oximeter, rechargeble cell aa, oxygenflowmeter, bp moniter mercury, vital bp cuff, vital bp cuff with bladder

Get oxygen cell Tender Alert...

Related Searched Keywords : oxygen cell

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us