Filters

List of elisa-test-kit Tenders

List of latest elisa-test-kit Tenders in Indian Tenders. Click on any elisa-test-kit Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for elisa-test-kit Tenders.

All-Tenders (18)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35645938 | 04 Nov, 2025

Tender Value : 0

Hyderabad - Telangana

Tender for gem bids for nitrile coated/nitrile hand gloves (v2), elisa test kits (v2), anodized aluminium frame, high end desktop computer, bod incubator, multipara monitor - low end, entry and mid level desktop computer, xlpe cable for working voltages up to and including 1.1 kv as per is 7098 (part 1), microscopes - pathological and research as per is 4381, is 5204, is 4381, is 5204, foot operated pedal bin or bucket for bio - medical waste collection

Central Government/Public Sector

TRN :35631048 | 05 Nov, 2025

Tender Value : 21.34 Lacs

Nainital - Uttaranchal

Tender for gem bids for anti rainbow trout oncorhynchus mykiss atlantic salmonsalmo salar igm monoclonal antibody lyophilized proteinprepared from bovine free tmb elisa substratesolutionsturbo250 ml per pack bovine serum albuminbsa protease free fatty acid free ph 7 0 50 grams per pack goat anti mouse igg h l secondary antibody hrpconjugated lyophilized polyclonal 2ml per vial hydroxylamine hydrochloride hi ar acs n 1 naphthylethylenediamine dihydrochloride hi ar acs nedd 2phenoxyethanol vanadium iii chloride sodium nitrite sodium nitrate hi lr hydrochloric acid concentrated sodium hypochlorite hi ar acs 4 w v solution ezassaytbars estimation kit for lipid peroxidation 100 reactions ezassaytm reactive oxygen species assay kit frap 200tests agarose low melting field test kit dneasy bloodand tissue kit 50 50 dneasy mini spin columns proteinasek buffers collection tubes 2 ml hematoxylin solution500ml eosin y solution 0 5 alcoholic 500ml histosec 60pastilles without dmso oxolinic acid iodophor chloramine t trihydrate potassium permanganate bhuvision soil nutrient analysis code hg bsna 100 test clearserological pipette 10ml amber glass vials ermamicrotome blades 1 2 propanediol 2 5l erlenmeyerconical flask multi port hplc cap micropipette weigert s iron hematoxylin kit 2x500ml eosin y 5g alcianblue 8gx 10g d p x 100ml paraplast plus 1kg 30acrylamide bis solution 29 1 l thick blot filter paper precut prestained protein ladder methanol glycerol biotin dsorbitol g418 disulfate salt potassium phosphate dibasic potassium phosphate monobasic ptriex 4 neo dnanovagen amicon ultra centrifugal filter 10 kda mwco ampicillin sodium salt imidazole dmso protease andphosphatase inhibitor cocktail tmb enhanced one bid number gem2025b6792045 dated 15-10-2025 bid document1 93 0 0 component hrp membrane substrate, 3 3diaminobenzidine, ammonium persulfate, cobalt iichloride, yepd broth granulated 500g, ypd yepd growthagar 500g, ypd yepd growth medium, yeast nitrogenbase ynb w ammonium sulphate 100g, peptone 500g, yeast extract powder, l histidine, dextrose anhydrous hiar acs, l glutamic acid, l methionine, l lysine hi lr, lleucine, l isoleucine, 10x tris glycine sds gel runningbuffer, 2 5x tris sds buffer ph 8 8, 5x tris sds buffer ph 68, 10x transfer buffer, 5x laemmli buffer, 50x tae, rnaisolation, sedgewick rafter counting chamber cell, borosilicate bod bottles, borosilicate dissolved oxygenbottles, uniflo 13mm 0 2 pes s 100 pk, uniflo 13mm 045 pes s 100 pk, uniflo 25mm 0 45 pes s 45 pk, uniflo25mm 0 2 pes s 45 pk, single tubes pcr 0 2 ml transparentwith attached flat cap, microcentrifuge tubes pp 0 5 ml withattached cap with lid closure, microcentrifuge tubes pp 1 5ml with attached cap with lid closure, microcentrifuge tubespp 2 0 ml with attached cap with lid closure, microcentrifuge tubes pp 5 ml transparent, mueller hintonagar granulated 500g, mueller hinton broth 500g, glucose yeast extract agar 500g, glucose yeast extractacetate broth 500g, agar granulated bacteriological grade500g, nutrient agar granulated, nutrient broth granulated, d glucose anhydrous, sodium chloride, xylene forhistopathology 2 5l, resazurin sodium salt 5g, z 2 cl osu100g, mtt 1g, n phenyl 1 naphthylamine 500g, propidium iodide, wizard genomic dna purification kit 100isolations x 300ul, wizard sv gel and pcr cleanup system50 prep, hepes molecular biology grade free acid 100g, disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg, petridish, centrifuge tube conical bottom with lid, selfstanding centrifuge tube with lid, cryovial with externalthreaded self standing sterile, cryo box pp, rack for microtube l, rack for micro tube, universal tube rack pp, universal tube rack, 20c mini cooler with gel filled cover, 0c mini cooler with nontoxic gel, agar powderbacteriological grade, mueller hinton agar, mueller hintonbroth, tryptone soya broth soyabean casein digestmedium, tryptone soya agar casein soyabean digest agarsoyabean casein digest agar, steriswift disinfectant wipes, polyethylene glycol mw 6000, sterile cotton swab, 2 10ulaerosol barrier gentip, 20 200ul aerosol barrier gentip, 100 1000ul aerosol barrier gentip, wrappup alluminiumfoils, biosoft tissue, kimwipes, kimberly clark, ecosafedisinfectant, centrifuge tube, petri dish, syringe

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35611939 | 03 Nov, 2025

Tender Value : 0

Mumbai - Maharashtra

Tender for gem bids for hiv elisa 4th generation kits kit of 96 tests hbsag elisa 4th generation kits kit of 96 tests hcv elisa 4th generation kits kit of 96 tests rpr rapid plasma reagin kit 1kit of 50 test rpr rapid plasma reagin kit 1kit of 50 test

Central Government/Public Sector

TRN :35606967 | 04 Nov, 2025

Tender Value : 0

New Delhi - Delhi

Tender for gem bids for rate, scub typhus igm elisa kit, optical adhesive film for pcrplates 1x100pcs, quantifluor dsdna system, leptospiraigm elisa kit, chromogranin -a, homocysteine enzymaticassay, multitest cd3 cd4 cd8 cd45, hepatitis c virus realtime pcr genotyping kit 48 test, dengue igm elisa 96 test, ethanol molecular grade 500ml, dengue ns1 ag elisa96test, myostatin mstn, ngal control, total bile acidassay, bioanalyzer high sensitivity dna analysis kit, ferritin, adenosine deaminase assay, ngal assay kit, optical 96 well reaction pcr plate 1x10pcs, adenosinedeaminase control, leucodepletion filter log 4 reduction ofwbc for platelet, test tube 12 x 100 plastic

State Government

TRN :35601373 | 01 Nov, 2025

Tender Value : 93.00 Lacs

Anand - Gujarat

Tender for gem bids for boqbunchrecurring, guide-it mutation detection kit gibson assembly cloningkit in-fusion hd cloning plus ce monarch or genelutespin dna gel extraction kit monarch or genelute spinplasmid miniprep kit cathode buffer container anodebuffer container bigdye terminator v31 cycle sequencingkit 1 pop-7 polymer cdna synthesis kit sybr green kit guide-it complete sgrna screening system acquitypremier peptide csh c18 column acquity uplc beh c18column waters acquity column in-line filter mfei-hf kpni-hf pmli bglii ecori-hf saci-hf sali-hf sbfi-hf fastdigest acc65i fastdigest maubi 10x tris acetateboric acid dithiothreitol dtt cysteine dmso depc carbecillin disodium cefotaxime powder kanamycinesulphate monohydrate rifampicin streptomycin sulphate hygromycin b 2 4-dichlorophenoxyacetic acid indole-3-acetic acid indole-3-butyric acid picloram 6-bap kinetin zeatin ga3 l-glutamine l-proline nitro bluetetrazolium riboflavin sodium carbonate proteaseinhibitor cocktail hydrogen peroxide solution guaiacol trichloroacetic acid hypergrade for lc-ms lichrosolvmethanol hypergrade for lc-ms lichrosolv acetonitrile acetic acid aluminum chloride acrylamide crystals amino acid standard - waters boron trifluoride etherate n-a-benzayal-l-arginine ethyal ester hydrochloride p-cumaricacid trans cinamic acid caffeic acid chlorogenic acid dihydroxy toluene 3-5 dimetoxi-4-hidroxicinamic diosgenin diethyl pyrocarbonate dithiothreitol 100 bpdna ladder-dye plus o-dianisidine l-dopa trans ferulicacid 99 alpha-glucosidase 4-hydroxy -3 methoxy benzoicacid jasmonic acid maltose mercuric oxide red myricetin nitroblue tetrazolium chloride napthyl acetate narginine papain phenyl methane sulphonyl fluoride protease phenazine methosulphate quarcetin saponin bid number gem2025b6772281 dated 11-10-2025 bid document1 130 0 0 sybr premix - tli rnas h plus, syringic acid, sinapic acid, sodium arsenate dibasic hydrate, 37 components fame mix, 2 3 5- tri phenyl tertazolium bromide, 2 4 6-tris 2-pyridyl-s-triazine, tannic acid, nnnn-tetramethyl ethylenediamine, vanilic acid, water sterile nuclease free, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phytic acid assay kit, trypsinactivity assay kit, 2 2-diphenyl-1-picrylhydrazyl, meta-phosphoric acid, amylose, l-amino acid assay kit, n-benzoyl-dl-arginine-p-nitroanilide bapa, trypsin - porcinepancreatic, methanol hplc grade, pancreatin, pepsin, potassium thiocyanate kscn, tannic acid standard, vanillin, tri chloro acetic acid, tris base, anthrone, hppvessel gasket, hpp sensor probe, pectinase, cellulase, phytic acid assay kit, tannin microplate assay kit, saponinmicroplate assay kit, n benzoyl-dl-arginine p-nitroanilidehydrochloride, trypsin solution, phosphotungsticphophomolybdic acid, neutrase, orthophthaldehyde, 2-mercaptoethanol, l-glutathione, l-serine, ultra centrifugalfilter 3 k da mwco, alpha glucosidase, ace inhibitoryactivity assay, indophenol dye, betacyanin, tuning andperformance standards for lc ms, methyl myristate, linolenic acid methyl ester, amino acid kit, 3 5-dinitrosalicylic acid reagent, p-nitrophenyl a-d-galactopyranoside, trypsin edta, acrylamide, n n-methylene bis-acrylamide, n n n n-tetramethylethylenediaamine, fluorometric, l-tyrosine, antimicrobial susceptibility test discs, mcfarlandstandard, phenol chloroform isoamyl alcohol, listeriamonocytogenes detection kit, dna ladder 100 bp, glycine-sodium hydroxide buffer, potassium acetate, betanin, quercetin, kaempferol, 96-well polystyrene microtiterplate, indicaxanthin, 2 2-diphenyl-l-picrylhydrazyl, proteinstandards for electrophoresis, acarbose extrapure, trisacetate edta buffer, tris borate edta buffer, listeriamonocytogenes atcc 700301 lyophilized culture, listeriamonocytogenes atcc 700302 lyophilized culture, papayamosaic virus elisa kit, papaya ringspot virus elisa kit, papaya leaf curl virus elisa kit, soybean mosaic viruselisa kit, urdbean crinkle virus elisa kit, mungbeanyellow mosaic virus elisa kit, okra enation leaf curl elisakitguide it mutation detection kit, gibson assemblycloningkit, in fusion hd cloning plus ce, monarch or genelute spindna gel extraction kit, monarch or genelute spin plasmidminiprep kit, cathode buffer container, anode buffercontainer, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplcbeh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfihf, fastdigest acc65i, fastdigest maubi, 10x tris acetateboric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycinesulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2, 4 dichlorophenoxyacetic acid, indole 3acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade forlc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phyticacid assay kit, trypsin activity assay kit, 2, 2 diphenyl 1picrylhydrazyl, meta phosphoric acid, amylose, l amino

Central Government/Public Sector

TRN :35589710 | 30 Oct, 2025

Tender Value : 0

New Delhi - Delhi

Tender for gem bids for ict for salmonella typhoid igm and igg, ict forprocalcitonin, hepatitis b surface antigen hbsagdetection elisa kit of 96 tests, latex agglutinationkit for ra factor pack of 100 test, latexagglutination crp kit of 50 test, widal test to thah bh kit of 4x5 ml, ict for detection of syphilis abrapid card test, ict for leptospira igm, ict forscrub typhus igg and igm both, rapid card test fordetection of hiv i and ii 4th gen rapid card test, rapid test for leishmaniasis igm plus igg combo, ictfor anti hcv rapid, ict for hbs ag rapid, tri levelimmunoassay control premium plus 10 x 5ml, microtips 20-200 ul box with 96 tips, elisa test forscrub typhus igm kit of 96 test

Central Government/Public Sector

TRN :35594334 | 31 Oct, 2025

Tender Value : 0

New Delhi - Delhi

Tender for gem bids for ana (10x12 wells) ifa kit 120 test , anti ccp2 elisa (96 wells) , anti mpo elisa (96 wells) , ana -lia (17 antigens of 24 strips)

Related Searched Keywords : elisa test kit

List of elisa-test-kit Tenders

Tender for gem bids for hiv elisa 4th generation kits kit of 96 tests hbsag elisa 4th generation kits kit of 96 tests hcv elisa 4th generation kits kit of 96 tests rpr rapid plasma reagin kit 1kit of 50 test rpr rapid plasma reagin kit 1kit of 50 test

Tender for gem bids for ana (10x12 wells) ifa kit 120 test , anti ccp2 elisa (96 wells) , anti mpo elisa (96 wells) , ana -lia (17 antigens of 24 strips)

Get elisa test kit Tender Alert...

Related Searched Keywords : elisa test kit

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us