Filters

List of dna-polymerase Tenders

List of latest dna-polymerase Tenders in Indian Tenders. Click on any dna-polymerase Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for dna-polymerase Tenders.

All-Tenders (3)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Central Government/Public Sector

TRN :35588488 | 30 Oct, 2025

Tender Value : 0

Bharatpur - Rajasthan

Tender for gem bids for macro tips 5ml, ammonium sulphate for plant tissue culture500 gm, calcium chloride dihydrate for tissue culture 500gm, sucrose for tissue culture 5 kg, sodium thiosulphateanhydrous extrapure ar 500 gm, agar tissue culture tested500 gm, wide mouth bottle ldpe, wide mouth squarebottle hdpe, jerrican hdpe, wash bottle new type, analytical long stem funnel pp, accupipet-starter kit, macro tips 5 ml, spinix- vortex shaker, spinwin mc-00micro centrifuge, nitrile gloves powder free, kimwipeswipes, test tube cap pp, planton, staining box pp, biohazard bags pp, autoclavable bags pp, 5-sulphosalicylicacid dihydrate acs, tris buffer for hplc 99 9, luria bertanibroth, luria bertani agar, n-hexane pure 99, agarosehigh eeo for molecular biology, citric acid anhydrousextrapure 99, sodium bicarbonate extrapure, 99, silica gelblue self indicating coarse 58 mesh, boric acid extrapure99 5, phytic acid sodium salt hydrate insp6 extrapure 70, polyethylene glycol 6000 powder peg 6000, isopropanolipa for molecular biology 99 8, custom dna oligos 25 nmolin tubes hpsf purification full yiedl lyophilized qc with ladi tof, custom dna oligos 25 nmol in tubes hpsf purification fullyiedl lyophilized qc with ladi tof a, custom dna oligos 25nmol in tubes hpsf purification full yiedl lyophilized qc withladi tof b, custom dna oligos 25 nmol in tubes hpsfpurification full yiedl lyophilized qc with ladi tof c, customdna oligos 25 nmol in tubes hpsf purification full yiedllyophilized qc with ladi tof d, longamp taq dnapolymerase 500 units, q5 high-fidelity dna polymerase -100 units, ecori - 10000 units, bamhi - 10000 units, hind-iii-hf - 10000 units, bsai-hf v2 - 1000 units, primescrip 1ststrand cdna synthesis kit, e coli dh5 competent cells, ecoli dh5 competent cell, mighty cloning reagent set bluntend, mighty cloning reagent set blunt end s, waternuclease free, murashige skoog medium w o sucrose agar, hwso9, hwg09, salicyclic acid, indole-3-acetic acid iaa, 6-aminopurine vitamin b4, gibberellic acid ga3, jasmonic acid, ethephon, generuler 50 bp dna ladderready-to-use 50 g, generuler 1 kb dna ladder 5 x 50 g, dntp set 100 mm solutions 4 x 1 ml, dreamtaq dnapolymerase 500 u, 6x dna loading dye 5 x 1 ml, waternuclease-free 4 x 1 25 ml, water nuclease free 30 ml, phusion high-fidelity dna polymerase 100 u, 0 510 luniversal fit gentip natural, bulk low retention non sterile, 100 1000 l universal fit gentip natural, bulk bevelled lowretention non sterile, 0 2ml clear 96 well pcr plate noskirt high profile, sealing mat for 96 pcr plate white, storage rack for 1 5 2 0ml tubes assorted 100 well, autoclave bags 415 x 600mm, centrifuge tube with capconical, sterile racked, 25 well pc rack, micro tube rack1 5 ml, digital micro pipette, tips for gensleek-10000 clear, parafilm m sealing film, silicone lab mat, magbox, cubetube rack, adapt-a-rack, floating microtube rack, sample container, carboys with stopcock, 4-layer ppactivated carbon lab mask, tough-tags, thermo-labservesoft blue nitrile gloves, thermo-labserve soft blue nitrileglove, kimberly-clark purple nitrile gloves-m, safeskinpurple nitrile gloves-l, ethanol molecular biology grade, autoclavable bag, accupipette 1 5ml, moisture proofbottle with inner lid 1 litre, cuvettes disposable 4ml, testtube basket 160 160 160 mm, face mask, porcelainbuchner funnel, ceramic heater quartz tube-4l, doubledistillation unit 2 5 lph with quartz heater, ceramic //bid details2 / 61 heater quartz tube 2 5 l accs, circulating water bath 12ltr, magnetic stirrers heat stir, hot plate, glass dryer

Central Government/Public Sector

TRN :35569918 | 28 Oct, 2025

Tender Value : 0

Yelahanka - Karnataka

Tender for gem bids for chemical, phenol 500gpk, goat anti bovine igg h l secondaryantibody hrp, sheep anti bovine igm secondary antibodyhrp 1mg pk, gelatin from bovine skin 500g pk, protein gperoxidase from streptococcus sp 250ug pk, ophenylenediamine dihydrochloride 100tab, rb 2x taq pcrmaster mix premix taq dna polymerase with dntps andbuffer with green dye 500rxn, anti human igg fe specificperoxidase antibody produced in goat 1ml pk, anti humanigm u chain specific peroxidase antibody produced in goat1ml pk

Related Searched Keywords : dna polymerase

List of dna-polymerase Tenders

Get dna polymerase Tender Alert...

Related Searched Keywords : dna polymerase

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us