Filters

List of nainital Tenders

List of latest nainital Tenders in Indian Tenders. Click on any nainital Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for nainital Tenders.

All-Tenders (71)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

State Government

TRN :35609360 | 22 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for respirable dust sampler as per is 5182 q3

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

State Government

TRN :35611454 | 28 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for continuous ambient air quality monitoring system - sensorbased q3 *

Central Government/Public Sector

TRN :35611797 | 03 Nov, 2025

Tender Value : 26.00 Lacs

Nainital - Uttaranchal

Tender for gem bids for rainbow trout larval feed 0 point 3 mm pallet, rainbowtrout larval feed 0 point 5 mm pallet, rainbow trout larvalfeed 0 point 8 mm pallet, rainbow trout nursery feed 1point 2 mm floating pallet, rainbow trout grower feed 1point 8 mm floating pallet, rainbow trout grower feed 3mm floating pallet, rainbow trout grower feed 6 mmfloating pallet, rainbow trout nursery feed 0 point 8 mmpallet, rainbow trout early grower feed 1 point 2 mmfloating pallet, rainbow trout early grower feed 1 point 8mm floating pallet, carp feed 4 mm floating, plasticinsulated ice box, oxygen cylinder, weighing balance, drag net, hand net, hapa, polythene bag, silpoline, fishwader

State Government

TRN :35612351 | 03 Nov, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for nfion dryer

Central Government/Public Sector

TRN :35614048 | 23 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for upgradation and modernisation of grocery display shed aturc

State Government

TRN :35614829 | 21 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for laboratory desiccator (v2) (q3)

State Government

TRN :35614886 | 21 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for ministry of science and technology

Central Government/Public Sector

TRN :35606280 | 23 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for upgradation of esm billing convenience centre urc

Central Government/Public Sector

TRN :35606803 | 20 Oct, 2025

Tender Value : 0

Nainital - Uttaranchal

Tender for gem bids for addl work for construction of driving track

Related Locations of : Uttaranchal

List of nainital Tenders

Tender for gem bids for respirable dust sampler as per is 5182 q3

Tender for gem bids for continuous ambient air quality monitoring system - sensorbased q3 *

Tender for gem bids for nfion dryer

Tender for gem bids for upgradation and modernisation of grocery display shed aturc

Tender for gem bids for laboratory desiccator (v2) (q3)

Tender for gem bids for ministry of science and technology

Tender for gem bids for upgradation of esm billing convenience centre urc

Tender for gem bids for addl work for construction of driving track

Get Nainital Tender Alert...

Related Locations of : Uttaranchal

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us