Thetenders.com
  +91 92760 83333 / +91 92743 15555
  • Indian Tenders
  • |
  • Global Tenders
  • |
  • Projects
  • |
  • Tender Awarded
  • |
  • Sub-Contractor
  • Pay Online
  • Register now
  • Login
  • Indian Tenders Tender information of India
  • Global Tenders International Tender information
  • Projects Project information of India
  • Tender Awarded Tender awarded information
  • Sub-Contractor Vendor information of India
  • Pay Online
  • Register now
  • Login
  • Contact Info All India : 9276083333 / 9274315555 South India : 9274315555
TheTenders
»
Indian Tenders
»
Keyword Tenders
»
Lyophilized Powder
Filters
  • » By Keywords
  • » By Cities
  • » By States
  • » By Agencies
  • » By Sectors
  • » By Ownerships
  • Tender Value

List of lyophilized-powder Tenders

List of latest lyophilized-powder Tenders in Indian Tenders. Click on any lyophilized-powder Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for lyophilized-powder Tenders.

Advance Search
  • All-Tenders (8)
  • |
  • Today's-Tenders
  • |
  • Active-Tenders
  • |
  • Closed-Tenders
1 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35631048 |  05 Nov, 2025
Tender Value : 21.34 Lacs
 Nainital - Uttaranchal
Tender for gem bids for anti rainbow trout oncorhynchus mykiss atlantic salmonsalmo salar igm monoclonal antibody lyophilized proteinprepared from bovine free tmb elisa substratesolutionsturbo250 ml per pack bovine serum albuminbsa protease free fatty acid free ph 7 0 50 grams per pack goat anti mouse igg h l secondary antibody hrpconjugated lyophilized polyclonal 2ml per vial hydroxylamine hydrochloride hi ar acs n 1 naphthylethylenediamine dihydrochloride hi ar acs nedd 2phenoxyethanol vanadium iii chloride sodium nitrite sodium nitrate hi lr hydrochloric acid concentrated sodium hypochlorite hi ar acs 4 w v solution ezassaytbars estimation kit for lipid peroxidation 100 reactions ezassaytm reactive oxygen species assay kit frap 200tests agarose low melting field test kit dneasy bloodand tissue kit 50 50 dneasy mini spin columns proteinasek buffers collection tubes 2 ml hematoxylin solution500ml eosin y solution 0 5 alcoholic 500ml histosec 60pastilles without dmso oxolinic acid iodophor chloramine t trihydrate potassium permanganate bhuvision soil nutrient analysis code hg bsna 100 test clearserological pipette 10ml amber glass vials ermamicrotome blades 1 2 propanediol 2 5l erlenmeyerconical flask multi port hplc cap micropipette weigert s iron hematoxylin kit 2x500ml eosin y 5g alcianblue 8gx 10g d p x 100ml paraplast plus 1kg 30acrylamide bis solution 29 1 l thick blot filter paper precut prestained protein ladder methanol glycerol biotin dsorbitol g418 disulfate salt potassium phosphate dibasic potassium phosphate monobasic ptriex 4 neo dnanovagen amicon ultra centrifugal filter 10 kda mwco ampicillin sodium salt imidazole dmso protease andphosphatase inhibitor cocktail tmb enhanced one bid number gem2025b6792045 dated 15-10-2025 bid document1 93 0 0 component hrp membrane substrate, 3 3diaminobenzidine, ammonium persulfate, cobalt iichloride, yepd broth granulated 500g, ypd yepd growthagar 500g, ypd yepd growth medium, yeast nitrogenbase ynb w ammonium sulphate 100g, peptone 500g, yeast extract powder, l histidine, dextrose anhydrous hiar acs, l glutamic acid, l methionine, l lysine hi lr, lleucine, l isoleucine, 10x tris glycine sds gel runningbuffer, 2 5x tris sds buffer ph 8 8, 5x tris sds buffer ph 68, 10x transfer buffer, 5x laemmli buffer, 50x tae, rnaisolation, sedgewick rafter counting chamber cell, borosilicate bod bottles, borosilicate dissolved oxygenbottles, uniflo 13mm 0 2 pes s 100 pk, uniflo 13mm 045 pes s 100 pk, uniflo 25mm 0 45 pes s 45 pk, uniflo25mm 0 2 pes s 45 pk, single tubes pcr 0 2 ml transparentwith attached flat cap, microcentrifuge tubes pp 0 5 ml withattached cap with lid closure, microcentrifuge tubes pp 1 5ml with attached cap with lid closure, microcentrifuge tubespp 2 0 ml with attached cap with lid closure, microcentrifuge tubes pp 5 ml transparent, mueller hintonagar granulated 500g, mueller hinton broth 500g, glucose yeast extract agar 500g, glucose yeast extractacetate broth 500g, agar granulated bacteriological grade500g, nutrient agar granulated, nutrient broth granulated, d glucose anhydrous, sodium chloride, xylene forhistopathology 2 5l, resazurin sodium salt 5g, z 2 cl osu100g, mtt 1g, n phenyl 1 naphthylamine 500g, propidium iodide, wizard genomic dna purification kit 100isolations x 300ul, wizard sv gel and pcr cleanup system50 prep, hepes molecular biology grade free acid 100g, disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg, petridish, centrifuge tube conical bottom with lid, selfstanding centrifuge tube with lid, cryovial with externalthreaded self standing sterile, cryo box pp, rack for microtube l, rack for micro tube, universal tube rack pp, universal tube rack, 20c mini cooler with gel filled cover, 0c mini cooler with nontoxic gel, agar powderbacteriological grade, mueller hinton agar, mueller hintonbroth, tryptone soya broth soyabean casein digestmedium, tryptone soya agar casein soyabean digest agarsoyabean casein digest agar, steriswift disinfectant wipes, polyethylene glycol mw 6000, sterile cotton swab, 2 10ulaerosol barrier gentip, 20 200ul aerosol barrier gentip, 100 1000ul aerosol barrier gentip, wrappup alluminiumfoils, biosoft tissue, kimwipes, kimberly clark, ecosafedisinfectant, centrifuge tube, petri dish, syringe
  • View Tender
  • Document
  • Bid Support
2 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35610475 |  03 Nov, 2025
Tender Value : 16.98 Lacs
 Nainital - Uttaranchal
Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5
  • View Tender
  • Document
  • Bid Support
3 Security Services
image image
Central Government/Public Sector
TRN :35616608 |  25 Oct, 2025
Tender Value : 0
 Panchkula - Haryana
Tender for gem bids for onco, no 2 obq 0 monofilament polydioxanone pds suture violet70 to 80cm 1 obq 2 circle 30 to 40mm round bodied needlebis box of 12 no 3 obq 0 monofilament polydioxanone pdssuture violet length 70 to 80cm 1 obq 2 circle 30 to 40mmround bodied needle box of 12 no 4 obq 0 monofilamentpolydioxanone pds suture violet length 70 to 80cm 1 obq 2circle 20 to 25mm round bodied needle box of 12 no 5 obq0 monofilament polydioxanone pds suture violet length 40to 50cm 15 to 20mm 1 obq 2 circle round body needle bisand equivalent box of 12 black braided silk withneedle suture 3 obq8 circle reverse cutting 45 mmlength 76 cm size 2 obq 0 pack of 12 obqbox usfda synthetic absorbable polyglactin coated 1 obq2circle round body 16 mm braided length 70 cm size 4 obq0 pack of 12 obqbox usfda skin marking pen thickmarking with a flexible scale sterile peel open pouch vascular tapes red vascular tapes blue monofilamentpolyglecaprone absorbable suture size 3obq 0 70 to 90 cm1 obq2 circle taper cutting 20 to 30 mm needle eu bis andequivalent box of 12 aami level 3 reinforcedperformance sterile surgical gown consists of five layersfsms fabric with two hand towel bipolar disposablecautery leads vascular chemport 9point6 fr mricompatible with one way valve with introducer kit bovinecollagen patch coated with synthetic sealant nhs peg 27mmx27 mm bovine collagen patch coated with syntheticsealant nhs peg 45 mmx45 mm monopolar handswitchingdisposable sterile pencil disposable sterile monopolarcautery leads plug connector 3 pin banana plug control basic drape pack disposable sterile drape set for head andneck surgeries breast prosthesis external silicone teardrop shaped with under arm extension in light weight ariantassorted sizes with two bras having two pouches each bid number gem2025b6692939 dated 11-10-2025 bid document1 46 0 0 linear cutter stapler 60mm with interchangeable cartidgesto accommodate and use different colour reloads withtristaple technology, linear cutter stapler 80mm withinterchangeable cartidges to accommodate and usedifferent colour reloads with tristaple technology, linearcutter stapler reloads with inbuilt new knife and with threedifferent leg length 3point0mm 3point5mm and 4point0mmstaple lines, reusable clip applicator for open surgerycompatible with ligaclip 300, reusable clip applicator foropen surgery compatible with ligaclip 400, titanium linearcutter 75mm selectable staple height of 1point5 to 1point82point0mm titanium mri compatible in one cartridge, circular wound protector obqretractor with flexibleretraction ring small incision size 2point5 to 6 cm pack of 5, closed wound suction drain unit with 02 x perforated pvcdrain with 01 trocar 01 spring loaded bellows andconnecting tubing size 12 fr, breathabe reinforced highperformance aami level 4 sterile surgical gown soft knittedv neck collar consists of five layer sfsms non woven fabric, universal pack minor with short side drapes containing topdrape 276cm x 149cm bottam drape 165cm x 193cm sidedrape 2 83cm x 114cm, universal pack contain 1 outerwrap 90 cm x 90 cm 1 suture bag 1 bottom drape withcontrol reinfrocement 193 cm x 193cm 1 top drape, greenreloads 2point0mm close staple height with gripping surfacetechnology compatible with present powered stapler 45mm, powered vascular stapler 35 45mm with narrower curvedand blunt tip anvil with thinner shaft offering greatest angleof reach, double lumen pvc plastic tracheostomy tube withlow pressure cuff and speaking valve with 360 degreefreedom at neck flange size 7mm id, double lumen pvcplastic tracheostomy tube with low pressure cuff andspeaking valve with 360 degree freedom at neck flange size7point5 mm id, double lumen pvc plastic tracheostomytube with low pressure cuff and speaking valve with 360degree freedom at neck flange size 8mm id, knotlesstissue control device synthetic absorbable polydioxanonewith antibacterial triclosan coated 1 obq2 circle taper point26mm unidirectional, knotless tissue control device 1 obq2circle taper point sh26 mmpolydioxanone withtriclosan unidirectional with fixation tab 45cm size 3 bq0, knotless tissue control device synthetic absorbablepolydioxanone with antibacterial triclosan coated 1 obq2circle taper point 40mm unidirectional with fixation tab45cm size 1 box of 12, laparotomy drape with incise76inpoint x 120 in 193cm x 305cm fenestration having smscontrol plis fabric reinforcement meets the ammi, laparoscopic endobag retrieval device large 300 ml, laparoscopic endobag retreival device medium 200 ml, laparoscopic disposable veress needle 120mm, moldableskin barrier hydrocolloid flexible collar colostomy obqurostomy set cinsist of wafer 10 nos flange 10 nos stomapaste 02 powder 01 belt 01 size 57 mm, moldable skinbarrier hydrocolloid flexible collar colostomy obq urostomyset cinsist of wafer 10 nos flange 10 nos stoma paste 02powder 01 belt 01 size 70 mm, polyglyconate absorbableunidirectional barbed suture 3obq 0 17mm taper point 1obq2 circle 15cm box of 12, polyglyconate absorbableunidirectional barbed suture 2 0 26mm taper point 1 obq2circle 30cm box of 12, single lumen pvc plastictracheostomy tube with low pressure cuff size 7point0 mmid, single lumen pvc plastic tracheostomy tube with lowpressure cuff size 7point5mm id, white reload 1point0mmclose staple height with gripping surface technology    //bid details2 / 46 compatible with present powered stapler 60mm, sterilepowder free latex micro surgical gloves iso obqen obqastmcertified viral resistance tested light brown size 7point0, reusable insulated smoot tip stainess steel foot switchingbiopolar coagulation forceps hardy bayonet forceps withstops 20point9 cm 8point25, reusable insulated smoot tipstainless steel foot switching bipolar coagulation forcepssemkin forceps with stops 14cm 5point5 in tip 0point5mm, disposable automatic and semi automatic core biopsy gun12gx10 and 16cm length with a dual adjustable penetrationdepth of 18mm, disposable automatic and semi automaticcore biopsy gun 14g x10 and 16 cm length with adjustablepenetration depth of 18 mm and 25 mm, disposableautomatic and semi automatic core biopsy gun 16gx10 and16cm length with a dual adjustable penetration depth of18mm and 25mm, disposable automatic and semiautomatic core biopsy gun 18g x10 16 and 20 cm lengthwith adjustable penetration depth of 18 mm and 25 mm, incise drape made up of polyester film with an acrylicadhesive that contains a complex of iodoform n vinyl 2pyrrolidine with a iodine concentration, sterile indocyaninegreen usp 25 mg lyophilized powder for iv obq intraocularuse vial and 5 ml sterile distilled water with sterile singleuse syringe filter 0point2 micron, polyamide monofilamentsize 3 obq0 70 100cm 3 obq8 circle reverse cutting 2530mm box of 12 foils, synthetic oxidized re generatedcellulose double layered with peg and trilysine size 2 into 4cm, synthetic oxidized re generated cellulose doublelayered with peg and trilysine size 5 into 5 cm, syntheticoxidized re generated cellulose double layered with peg andtrilysine size 5 into 10 cm
  • View Tender
  • Document
  • Bid Support
4 Agricultural And Floriculture And Silviculture Products
image image
State Government
TRN :35601373 |  01 Nov, 2025
Tender Value : 93.00 Lacs
 Anand - Gujarat
Tender for gem bids for boqbunchrecurring, guide-it mutation detection kit gibson assembly cloningkit in-fusion hd cloning plus ce monarch or genelutespin dna gel extraction kit monarch or genelute spinplasmid miniprep kit cathode buffer container anodebuffer container bigdye terminator v31 cycle sequencingkit 1 pop-7 polymer cdna synthesis kit sybr green kit guide-it complete sgrna screening system acquitypremier peptide csh c18 column acquity uplc beh c18column waters acquity column in-line filter mfei-hf kpni-hf pmli bglii ecori-hf saci-hf sali-hf sbfi-hf fastdigest acc65i fastdigest maubi 10x tris acetateboric acid dithiothreitol dtt cysteine dmso depc carbecillin disodium cefotaxime powder kanamycinesulphate monohydrate rifampicin streptomycin sulphate hygromycin b 2 4-dichlorophenoxyacetic acid indole-3-acetic acid indole-3-butyric acid picloram 6-bap kinetin zeatin ga3 l-glutamine l-proline nitro bluetetrazolium riboflavin sodium carbonate proteaseinhibitor cocktail hydrogen peroxide solution guaiacol trichloroacetic acid hypergrade for lc-ms lichrosolvmethanol hypergrade for lc-ms lichrosolv acetonitrile acetic acid aluminum chloride acrylamide crystals amino acid standard - waters boron trifluoride etherate n-a-benzayal-l-arginine ethyal ester hydrochloride p-cumaricacid trans cinamic acid caffeic acid chlorogenic acid dihydroxy toluene 3-5 dimetoxi-4-hidroxicinamic diosgenin diethyl pyrocarbonate dithiothreitol 100 bpdna ladder-dye plus o-dianisidine l-dopa trans ferulicacid 99 alpha-glucosidase 4-hydroxy -3 methoxy benzoicacid jasmonic acid maltose mercuric oxide red myricetin nitroblue tetrazolium chloride napthyl acetate narginine papain phenyl methane sulphonyl fluoride protease phenazine methosulphate quarcetin saponin bid number gem2025b6772281 dated 11-10-2025 bid document1 130 0 0 sybr premix - tli rnas h plus, syringic acid, sinapic acid, sodium arsenate dibasic hydrate, 37 components fame mix, 2 3 5- tri phenyl tertazolium bromide, 2 4 6-tris 2-pyridyl-s-triazine, tannic acid, nnnn-tetramethyl ethylenediamine, vanilic acid, water sterile nuclease free, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phytic acid assay kit, trypsinactivity assay kit, 2 2-diphenyl-1-picrylhydrazyl, meta-phosphoric acid, amylose, l-amino acid assay kit, n-benzoyl-dl-arginine-p-nitroanilide bapa, trypsin - porcinepancreatic, methanol hplc grade, pancreatin, pepsin, potassium thiocyanate kscn, tannic acid standard, vanillin, tri chloro acetic acid, tris base, anthrone, hppvessel gasket, hpp sensor probe, pectinase, cellulase, phytic acid assay kit, tannin microplate assay kit, saponinmicroplate assay kit, n benzoyl-dl-arginine p-nitroanilidehydrochloride, trypsin solution, phosphotungsticphophomolybdic acid, neutrase, orthophthaldehyde, 2-mercaptoethanol, l-glutathione, l-serine, ultra centrifugalfilter 3 k da mwco, alpha glucosidase, ace inhibitoryactivity assay, indophenol dye, betacyanin, tuning andperformance standards for lc ms, methyl myristate, linolenic acid methyl ester, amino acid kit, 3 5-dinitrosalicylic acid reagent, p-nitrophenyl a-d-galactopyranoside, trypsin edta, acrylamide, n n-methylene bis-acrylamide, n n n n-tetramethylethylenediaamine, fluorometric, l-tyrosine, antimicrobial susceptibility test discs, mcfarlandstandard, phenol chloroform isoamyl alcohol, listeriamonocytogenes detection kit, dna ladder 100 bp, glycine-sodium hydroxide buffer, potassium acetate, betanin, quercetin, kaempferol, 96-well polystyrene microtiterplate, indicaxanthin, 2 2-diphenyl-l-picrylhydrazyl, proteinstandards for electrophoresis, acarbose extrapure, trisacetate edta buffer, tris borate edta buffer, listeriamonocytogenes atcc 700301 lyophilized culture, listeriamonocytogenes atcc 700302 lyophilized culture, papayamosaic virus elisa kit, papaya ringspot virus elisa kit, papaya leaf curl virus elisa kit, soybean mosaic viruselisa kit, urdbean crinkle virus elisa kit, mungbeanyellow mosaic virus elisa kit, okra enation leaf curl elisakitguide it mutation detection kit, gibson assemblycloningkit, in fusion hd cloning plus ce, monarch or genelute spindna gel extraction kit, monarch or genelute spin plasmidminiprep kit, cathode buffer container, anode buffercontainer, bigdye terminator v3.1 cycle sequencing kit 1, pop 7 polymer for 3500seqstudio flex, cdna synthesis kit, sybr green kit, guide it complete sgrna screening system, acquity premier peptide csh c18 column, acquity uplcbeh c18 column, waters acquity column in-line filter, mfei hf, kpni hf, pmli, bglii, ecori hf, saci hf, sali hf, sbfihf, fastdigest acc65i, fastdigest maubi, 10x tris acetateboric acid, dithiothreitol dtt, cysteine, dmso, depc, carbecillin disodium, cefotaxime powder, kanamycinesulphate monohydrate, rifampicin, streptomycin sulphate, hygromycin b, 2, 4 dichlorophenoxyacetic acid, indole 3acetic acid, indole 3 butyric acid, picloram, 6 bap, kinetin, zeatin, ga3, l glutamine, l proline, nitro blue tetrazolium, riboflavin, sodium carbonate, protease inhibitor cocktail, hydrogen peroxide solution, guaiacol, trichloroacetic acid, hypergrade for lc ms lichrosolv methanol, hypergrade forlc ms lichrosolv acetonitrile, aflatoxin g1, aflatoxin g2, aflatoxin b1, aflatoxin b2, hemicellulase, alcalase, phyticacid assay kit, trypsin activity assay kit, 2, 2 diphenyl 1picrylhydrazyl, meta phosphoric acid, amylose, l amino
  • View Tender
  • Document
  • Bid Support
5 Education And Research Institutes
image image
Central Government/Public Sector
TRN :35588488 |  30 Oct, 2025
Tender Value : 0
 Bharatpur - Rajasthan
Tender for gem bids for macro tips 5ml, ammonium sulphate for plant tissue culture500 gm, calcium chloride dihydrate for tissue culture 500gm, sucrose for tissue culture 5 kg, sodium thiosulphateanhydrous extrapure ar 500 gm, agar tissue culture tested500 gm, wide mouth bottle ldpe, wide mouth squarebottle hdpe, jerrican hdpe, wash bottle new type, analytical long stem funnel pp, accupipet-starter kit, macro tips 5 ml, spinix- vortex shaker, spinwin mc-00micro centrifuge, nitrile gloves powder free, kimwipeswipes, test tube cap pp, planton, staining box pp, biohazard bags pp, autoclavable bags pp, 5-sulphosalicylicacid dihydrate acs, tris buffer for hplc 99 9, luria bertanibroth, luria bertani agar, n-hexane pure 99, agarosehigh eeo for molecular biology, citric acid anhydrousextrapure 99, sodium bicarbonate extrapure, 99, silica gelblue self indicating coarse 58 mesh, boric acid extrapure99 5, phytic acid sodium salt hydrate insp6 extrapure 70, polyethylene glycol 6000 powder peg 6000, isopropanolipa for molecular biology 99 8, custom dna oligos 25 nmolin tubes hpsf purification full yiedl lyophilized qc with ladi tof, custom dna oligos 25 nmol in tubes hpsf purification fullyiedl lyophilized qc with ladi tof a, custom dna oligos 25nmol in tubes hpsf purification full yiedl lyophilized qc withladi tof b, custom dna oligos 25 nmol in tubes hpsfpurification full yiedl lyophilized qc with ladi tof c, customdna oligos 25 nmol in tubes hpsf purification full yiedllyophilized qc with ladi tof d, longamp taq dnapolymerase 500 units, q5 high-fidelity dna polymerase -100 units, ecori - 10000 units, bamhi - 10000 units, hind-iii-hf - 10000 units, bsai-hf v2 - 1000 units, primescrip 1ststrand cdna synthesis kit, e coli dh5 competent cells, ecoli dh5 competent cell, mighty cloning reagent set bluntend, mighty cloning reagent set blunt end s, waternuclease free, murashige skoog medium w o sucrose agar, hwso9, hwg09, salicyclic acid, indole-3-acetic acid iaa, 6-aminopurine vitamin b4, gibberellic acid ga3, jasmonic acid, ethephon, generuler 50 bp dna ladderready-to-use 50 g, generuler 1 kb dna ladder 5 x 50 g, dntp set 100 mm solutions 4 x 1 ml, dreamtaq dnapolymerase 500 u, 6x dna loading dye 5 x 1 ml, waternuclease-free 4 x 1 25 ml, water nuclease free 30 ml, phusion high-fidelity dna polymerase 100 u, 0 510 luniversal fit gentip natural, bulk low retention non sterile, 100 1000 l universal fit gentip natural, bulk bevelled lowretention non sterile, 0 2ml clear 96 well pcr plate noskirt high profile, sealing mat for 96 pcr plate white, storage rack for 1 5 2 0ml tubes assorted 100 well, autoclave bags 415 x 600mm, centrifuge tube with capconical, sterile racked, 25 well pc rack, micro tube rack1 5 ml, digital micro pipette, tips for gensleek-10000 clear, parafilm m sealing film, silicone lab mat, magbox, cubetube rack, adapt-a-rack, floating microtube rack, sample container, carboys with stopcock, 4-layer ppactivated carbon lab mask, tough-tags, thermo-labservesoft blue nitrile gloves, thermo-labserve soft blue nitrileglove, kimberly-clark purple nitrile gloves-m, safeskinpurple nitrile gloves-l, ethanol molecular biology grade, autoclavable bag, accupipette 1 5ml, moisture proofbottle with inner lid 1 litre, cuvettes disposable 4ml, testtube basket 160 160 160 mm, face mask, porcelainbuchner funnel, ceramic heater quartz tube-4l, doubledistillation unit 2 5 lph with quartz heater, ceramic    //bid details2 / 61 heater quartz tube 2 5 l accs, circulating water bath 12ltr, magnetic stirrers heat stir, hot plate, glass dryer
  • View Tender
  • Document
  • Bid Support
6 Municipal Corporation
image image
corporations/Associations/Others
TRN :35594319 |  25 Oct, 2025
Tender Value : 0
 Solapur - Maharashtra
Tender for gem bids for topical lignocaine xylocaine 4percent , diazepam oral liquid 2mg per 5ml , adrenaline inj. 1mg per ml , cetrizine hydrochloride tab 10mg , chlorpheniramine maleate tab 4mg , paracetamol tab 500mg , paracetamol tab 650mg , paracetamol drops 15ml , paracetamol syrup 60ml bottle , diclofenac sodium 25mg per ml inj. , diclofenac sodium tab. 50mg , ibuprofen tab. 200mg , ibuprofen tab. 400mg , ibuprofen syrup 60ml bottle , lignocaine with hydrocortisone zinc oxide anovateperpilorute cream , amoxycillin cap. 250mg , amoxycillin cap. 500mg , amoxycillin syrup 250mg 60ml bottle , gentamycin inj. 10mg , gentamycin inj. 40mg , ciprofloxacin tab. 250mg , ciprofloxacin tab. 500mg , metronidazole tab 200mg , metronidazole tab 400mg , fluconazole tab 150mg , diethylcarbamazine citrate tab ip 50mg , diethylcarbamazine citrate tab ip 100mg , albendazole tab 400mg , primaquine tab 2.5mg , primaquine tab 7.5mg , primaquine tab 15mg , artesunate tab 50mg , artesunate tab 200mg , glyceryl trinitrate sublingual tabs 0.5mg , isosorbide dinitrate tab 5mg , isosorbide dinitrate tab 10mg , atropine inj 0.6mg per ml , enalapril tab 2.5mg , enalapril tab 5mg , amlodepin tab. 2.5mg , amlodepin tab. 5 mg , amlodepin tab. 10 mg , atenelol tab 50mg , atenelol tab 100mg , frusemide tab. 40mg , metformin tab 500mg , metformin tab 750mg , metformin tab 1000mg , glimiperide 1mg tab , glimiperide 2mg tab , salbutamol tab 2mg , salbutamol tab 4mg , salbutamol 200mcg rotacaps powder puff , salbutamol syrup 2mg per 5ml 100ml bottle , xylometazoline nasal drops , rotahalers , phenobarbitone tab 30mg , phenobarbitone tab 60mg , phenobarbitone syrup20mg per 5ml 60ml bottle , phenytoin tab 50mg , phenytoin tab 100mg , phenytoin tab 300mg , phenytoin inj 50mg per ml , phenytoin sodium er tablet 300mg , sodium valporate tab 200mg , sodium valporate tab 500mg , carbamezapine tab 100mg , cap. mefenamic acid 250mg , cap. mefenamic acid 500mg , acetyl salicylic acid tab. 75mgi.p , acetyl salicylic acid tab. 300mg i.p , clopidogrel tab 75mg , vitamin k3 water soluble inj , antisnake venom serum strerile powder with strerile water, lyophilized sterile solution 10ml , human insulin plain 40iu per ml , human insulin nph isophane 40iu per ml , cholecalciferol 1000 iu granules sachet , cholecalciferol 60000 iu granules sachet , hydrocortisone sodium succinate inj. 100mg , dexamethasone inj. 4mg per ml , water for injection 5ml , water for injection 10ml , ferrous fumarate syrup 100ml bottle , folic acid tab 400mcg , folic acid tab 5mg , iron plus folic acid tab 100 mg of elemental iron plus folic acid i p 0.5 mg , vitamin a capsule 5000 iu , vitamin a capsule 50000 iu , vitamin a capsule 100000 iu , vitamin a concetrated solution 100ml , ascorbic acid vitamin c 500mg , ciprofloxacin eye per ear drop 5ml , sodium chloride 6percent w vpereye drop 5ml , clotrimazole ear drops 10ml , boro spirit ear drops 5ml , liquid paraffin menthol drops 100ml , chlorpheniramine maleate syrup 100 ml , activated charcoal oral , inj. pralidoxime chloride 500 mg pam , inj. pralidoxime chloride 1 gm pam , spironolactone tab 25mg , spironolactone tab 50mg , propranolol tab 10mg , propranolol tab 40mg , propranolol tab 80mg
  • View Tender
  • Document
  • Bid Support
7 Railway Transport
image image
Central Government/Public Sector
TRN :35578112 |  22 Oct, 2025
Tender Value : 0
 Kolkata - West Bengal
Tender for supply of running contract for inj.lyophilized powder contains follitropin alfa recombinant dna follicle stimulating hormone 75 iu 5.5mcg in vial packing..
  • View Tender
  • Document
  • Bid Support
8 Security Services
image image
Central Government/Public Sector
TRN :35534082 |  25 Oct, 2025
Tender Value : 2.09 Lacs
 Pune - Maharashtra
Tender for gem bids for phytohemagglutinin m-form (pha-m) , lyophilized , dapi/antifade mounting solution 150 ng/ml , colcemid solution for cell culture (10ml/bottle) , tween 20 (500ml/bottle) , 20 x ssc molecular grade powder (bottle of 500 gms)
  • View Tender
  • Document
  • Bid Support
  • 1
  • Tenders Expired In - 2025
  • Tenders Expired In - 2024
  • Tenders Expired In - 2023
  • Tenders Expired In - 2022
  • Tenders Expired In - 2021
  • Tenders Expired In - 2020
  • Tenders Expired In - 2019
  • Tenders Expired In - 2018
  • Tenders Expired In - 2017
  • Tenders Expired In - 2016
  • Tenders Expired In - 2015
Related Searched Keywords : lyophilized powder
  • Hydroxychloroquine Sulphate Tab Tenders ,
  • Green Oxy Tablet Tenders ,
  • Diabetrol Tab Tenders ,
  • Mitomycin Tenders ,
  • Chromium Tablet Tenders ,
  • Acyclovir Tenders ,
  • Norfloxacin And Metronidazole Syp Tenders ,
  • Hyrax Tab Tenders ,
  • Acetaminophen Capsule Tenders ,
  • Lenalidomide Capsule Tenders

Get lyophilized powder Tender Alert...

001650

Related Searched Keywords : lyophilized powder

  • Fencing Work Tenders From Maharashtra
  • Submersible Borewell Tenders From Delhi
  • Sewer Lines Tenders From West-Bengal
  • Brickwork Tenders From -Tamil-Nadu
  • Bridge Tenders From Andhra-Pradesh
  • Boundry Wall Tenders From Gujarat
  • Interlock Paver Tenders From Karnataka
  • Civil Work Tenders From Uttar-Pradesh
  • Renovation Work Tenders From Rajasthan
  • False Ceiling Work Tenders From Madhya-Pradesh

Read More


Tender Document

735931

State Tenders »

  • Maharashtra Tenders
  • Delhi Tenders
  • West Bengal Tenders
  • Tamil Nadu Tenders
  • Andhra Pradesh Tenders

City Tenders »

  • Hyderabad Tenders
  • Visakhapatnam Tenders
  • Guwahati Tenders
  • Patna Tenders
  • Chandigarh Ut Tenders

Keyword Tenders »

  • Wall Fencing Tenders
  • Fencing Work Tenders
  • Lift Irrigation Service Tenders
  • Infrastructure Works Tenders
  • Drilling Work Tenders

Sector Tenders »

  • Drugs And Pharmaceuticals Tenders
  • Survey Work Tenders
  • Shipping Transport Tenders
  • Scientific Research And Instruments Tenders
  • Security Services Tenders

Ownership Tenders »

  • Central Government And Public Sector Tenders
  • Co Operative Tenders
  • Corporations And Associations And Others Tenders
  • Private Sector Tenders
  • State Government Tenders

Indian Segment

  • State Tenders
  • City Tenders
  • Industry Tenders
  • SubIndustry Tenders
  • Sector Tenders
  • Ownership Tenders
  • Agency Tenders
  • Keyword Tenders
  • Source of Tenders

Browse Tenders

  • RFP-RFQ Tenders
  • Vender Registration Tenders
  • ICB Tenders
  • NCB Tenders
  • Auction Tenders
  • Corrigendum Tenders
  • E Procurement Tenders
  • GeM Tenders (Registration)

Global Segment

  • Middle East Countries Tenders
  • European Countries Tenders
  • African Countries Tenders
  • Asian Countries Tenders
  • Saar Countries Tenders
  • Australia Oceania Countries Tenders
  • South America Countries Tenders
  • North America Countries Tenders

Others

  • Services
  • Sitemap
  • About Us
  • Contact Us
  • Career
  • Tender Consultants
  • Terms & Conditions
  • Privacy & Policy

Get in touch with us

  • +91-92760 83333 (In India)
    +91-92743 15555 (South India)

  • sales@thetenders.in / ceo@thetenders.in

W B


Copyright ©2018 - Thetenders.com.

Download Mobile App