Filters

List of elisa-test-kit Tenders

List of latest elisa-test-kit Tenders in Indian Tenders. Click on any elisa-test-kit Tenders to view BOQ, NIT and Tender Documents. Get GeM Registration and Bidding Support, Vendor Registration for elisa-test-kit Tenders.

All-Tenders (17)
|
Today's-Tenders
|
Active-Tenders
|
Closed-Tenders

corporations/Associations/Others

TRN :35707125 | 04 Nov, 2025

Tender Value : 0

Bangalore - Karnataka

Tender for gem bids for hcv elisa test kits q2

Central Government/Public Sector

TRN :35700340 | 01 Nov, 2025

Tender Value : 0

Gurdaspur - Punjab

Tender for gem bids for dglp, bid number gem2025b6811875 dated 22-10-2025 bid document1 53 0 0 erba h560 lyse 01 4x200ml, erba h560 lyse 02 3x500ml, typhoid igg pack of 30 test ctk, erba h560 cell clean4x50ml, erba wash solution 4x50ml, erba h560 controllow normal high, kit for estimation of urea kit of 5x20mlerba, kit for estimation cholesterol 5 x20ml erba, kit forestmation of triglyceride pack of 5x20ml erba, kit forestimation of hdl cholesterol pack of 2x50ml erba, kits forestimation of sgpt alt erba 5x20ml, kits for estimation ofalkaline phosphate erba pack of 6x6ml, kit for estimation ofamylase erba 6x6ml, kit for estimation of ldh erba pack 4x 8ml, ckmb kit erba pack of 2x8ml, kit for dengue iggigm and ns1 ag card kit of 10 tests, hbsag card pkt of 100test, vdrl cards pack of 30 test ctk, hcv tridot j mitrapkt of 100, ra factor kit of 50 test, glucose powder, microtips 05 to 200ul pack of 1000, micro tips 200 to 1000micro ltr, distilled water 10ltr, t3 elisa kit erba kit of 96test, t4 elisa kit erba kit of 96 test, tsh elisa kit erba kitof 96 test, kit for estimation of bilirubin erba kit of 2x60ml, erba norm control, erba path control, h-560 calibrator, hiv tridot pkt of 100 j mitra, kit for estimation of ggtgamma glutamyl transaminase erba, kit for estimation oflipase erba, urine strips 10 sg multistix bott of 100 stripssiemens, bhi bottle for adult aerobic hi media, bhi bottlefor paediatric aerobic, crp kit quantitative erba, sodiumhypochlorite soloution, water culture kit pack of 10 test himedia, pregnancy test card pack of 100 strips, prothombinpt inr kit siemens, malaria paracheck kit pack of 30 test, microbiology disposable presterile petri dishes 90mmx15mm, kit for estimation of calcium erba kit of 2x50ml, tissue roll, microbiology clead agar base bottle of 500 gms, microbiology blood agar base bottle of 500 gms, microbiology mueller hinton agar bottle of 500 gm, microbiology macconkey agar bottle of 500 gms, microbiology mcconkey broth bottle of 500 gms, serumanti d igg type, anti-sera a monoclonal, anti-sera bmonoclonal, anti-sera ab monoclonal, i - chroma t3 kitpack of 25 test, i - chroma t4 pack of 25 test, i - chromatsh kit pack of 25 test, i - chroma hba1c kit pack of 25test, i-chroma kits pct pack of 1x10 test, i-chroma vitd kit pack of 1x25 test, aluminium foils, vaccum bloodcollection tubes with needles edta 2ml or 3ml pack of 100, vaccum blood collection tubes with needles sterile tubewith gel 5ml pack of 100, vaccum blood collection tubeswith needles sodium fluoride 2ml pack of 100, standard a250 ml meril quantilyte, standard b 250 ml meril quantilyte, qc soloution, cleaning solution 110ml, urine drug testkit of 10 test

State Government

TRN :35691238 | 05 Nov, 2025

Tender Value : 0

Noida - Uttar Pradesh

Tender for gem bids for research, scrub typhus igm elisa, filter tips 20ul, filter tips 300ul, hsv 1 igm elisa kit, hsv 2 igm elisa kit, leptospirosiscard test immunochromatographic, leptospira igm elisa, real time pcr for orientia tsutsugamushi, real time rtpcrkit for detection of dengue infection and its serotypes, realtime rt pcr kit for detection of pandemic hini seasonalh3n2 strains of lnfluenza a and influenza b, real time rtpcr kit for detection of cmv, real time rt pcr kit fordetection of hsv 1 and 2, real time rtpcr kit fordetection of hpv, tropical fever panel pcr kit, neuropanel, total viral nucleic acid extraction kit, cervicalspecimen collection kit, viral transport medium kit

Central Government/Public Sector

TRN :35691412 | 01 Nov, 2025

Tender Value : 0

Hyderabad - Telangana

Tender for gem bids for aso anti streptolysin-o test kits v2 q2, c - reactiveprotein crp test kits q2, rheumatoid factor test kit -ra test kit v2 q2, chikungunya rapid test kits v2q2, hcv rapid test kits q2, hbsag rapid test kits q2, typhoid rapid test kits q2, leptospira rapid test kitsv2 q2, syphilis rapid test kits q2, hbsag elisa testkits q2, hcv elisa test kits q2, anti-hev elisa testkits v2 q2, dengue elisa test kit q2, anti-hav elisatest kits v2 q2 % % % % 3 3 1 1 /oem average turnover last 3 years31 lakh s 2 2 // 56 56 % %/years of past experience required forsame/similar service2 year s 1 1 % % 9 :9 : /mse exemption for years of experienceand turnoveryes | complete& % & % 1 1 % % 9 9 / startup exemption for years ofexperience and turnoveryes | complete ; ; & & /document requiredfrom sellerexperience criteria, certificate requested in atc, oemauthorization certificate, oem annual turnover, additionaldoc 1 requested in atc*in case any bidder is seeking exemption from experience /turnover criteria, the supporting documents to prove hiseligibility for exemption must be uploaded for evaluation bythe buyer /bid number: gem/2025/b/6627844> /dated: 22-10-2025 & & / bid document1 / 21 e e g g h h > > & g & g i i g g > > k k? ? % % /do you want to showdocuments uploaded by bidders to allbidders participated in bid?yes documents submitted as part of a clarification orrepresentation during the tender/bid process will also bedisplayed to other participated bidders after log in & & o o / minimum number ofbids required to disable automatic bidextension3> g> g , , 5 5 -- / / number of days for which bidwould be auto--extended7 e i e i > > > > / /number of auto extension count1 t %t % >; >; > > /bid to ra enabledyest %t % u u /ra quali cation ruleh1-highest priced bid elimination 9 9 /type of bidtwo packet bid9 9 w w /primary product categoryanti-hev elisa test kits v2 x x & z & z /time allowed for technicalclarifications during technical evaluation2 days 6 6 o o 6 6 9 9 / % % i g i g h h /inspection required byempanelled inspection authority / agenciespre-registered with gemno x x /evaluation methodtotal value wise evaluation & & /arbitration clauseno /mediation clauseno //bid details /emd detail k /advisory bankbank of baroda /emd amount30496 /epbg detail k /advisory bankbank of baroda 9 %/epbg percentage%5.002 / 21 o /duration of epbgrequired months.26a. 1 ` % & 9& % & % 9 k a t g /emd exemption: the bidder seeking emd exemption, must submit the valid supporting documentfor the relevant category as per gem gtc with the bid. under mse category, only manufacturers for goods andservice providers for services are eligible for exemption from emd. traders are excluded from the purview of thispolicy.b. , , b 6 i > / emd & performance securityshould bein favour of beneficiary, wherever it is applicable. b b /beneficiary : executive directoraiims bibinagar hyderabad, department of health and family welfare, all india institute of medical sciencesaiims, ministry of health and family welfarethe executive director, aiims bibinagar > / bid splitting not applied. / mii purchase preference / mii purchase preferenceyes > ; i 9, > x l1+x% i / purchasepreference to mii sellers availabele upto pricewithin l1+x%20 > i 9 9 / maximum percentage of bidquantity for mii purchase preference50 % - - > 9 2017 e 1/e 2 & % % > 16.09.2020 - / allowparticipation only from class 1/class 2 localsuppliers as per the publicprocurementpreference to make-in-india order2017 date 16.09.2020as amended andapplicable time to timeyes, in compliance with the mii order : dpiit orderasamended and applicable time to time /mse purchase preference /mse purchase preferenceyes h j % i9, > x l1+x% i /purchase preference to mse oems available uptoprice within l1+x%153 / 21 h j i 9 9 / maximumpercentage of bid quantity for mse purchasepreference251. if the bidder is a micro or small enterprise as per latest orders issued by ministry of msme, the bidder shall beexempted from the eligibility criteria of experience criteria as defined above subject to meeting of quality andtechnical specifications. the bidder seeking exemption from experience criteria, shall upload the supportingdocuments to prove his eligibility for exemption.2. if the bidder is a micro or small enterprise mse as per latest orders issued by ministry of msme, the biddershall be exempted from the eligibility criteria of bidder turnover as defined above subject to meeting of qualityand technical specifications. if the bidder itself is mse oem of the offered products, it would be exempted fromthe oem average turnover criteria also subject to meeting of quality and technical specifications. the bidderseeking exemption from turnover, shall upload the supporting documents to prove his eligibility for exemption.3. if the bidder is a dpiit registered startup, the bidder shall be exempted from the the eligibility criteria ofexperience criteria as defined above subject to their meeting of quality and technical specifications. the bidderseeking exemption from experience criteria, shall upload the supporting documents to prove his eligibility forexemption.4. if the bidder is a dpiit registered startup, the bidder shall be exempted from the the eligibility criteria ofbidder turnover as defined above subject to their meeting of quality and technical specifications. if the bidderis dpiit registered oem of the offered products, it would be exempted from the oem average turnover criteriaalso subject to meeting of quality and technical specifications. the bidder seeking exemption from turnover shallupload the supporting documents to prove his eligibility for exemption. 5. experience criteria: in respect of the filter applied for experience criteria, the bidder or its oem of the productoffered in the bid themselves or through resellers should have regularly, manufactured and supplied same or

Central Government/Public Sector

TRN :35675606 | 08 Nov, 2025

Tender Value : 20.68 Lacs

Pune - Maharashtra

Tender for gem bids for thermal printer paper roll size 110mm x 20 mtr, coverslip 50 x 22, disposable trimming blade handle 130mm, disposable trimming blade handle 260 mm, micropipettes sterile filter tips for 0 point 2 to 10micro ltr pack of 96 per 10 extended lengthtarsons, microscopic slides grounded edges size 76 mm x26 mm x 1 point 15 to 1 point 35 mm refractive, microtips 200ul filter barrier and sterile, acla iggelisa 96 test kit, acla igm elisa 96 test kit, anti ccpelisa kit kit of 96 tests, anti nuclear antibody elisadetection kit with 96 wells, antistreptolysin o test latexagglutination principle coma complete with control serum, c reactive protein kit for 50 tests, hav igm elisa kit kit of96 tests, hev igm elisa kit kit of 96 tests, ige elisa kitkit of 96 tests, kit for torch test having kits for herpesfor igg kits for elisa 96 wells, kit for torch test having kitsfor herpes for igm kits for elisa 96 wells, kit for tumourmarker ca 15 point 3 kit for elisa 96 tests, kits fortumour markers afp kits for elisa 96 wells, kits fortumour markers ca 125 kit for elisa 96 wells, kitsfor tumour markers ca 19 point 9 kits for elisa 96 wells, kits for tumour markers cea kits for elisa 96 wells, kits fortumour markers hcg kits for elisa 96 wells, kits for tumourmarkers psa kits for elisa 96 wells, rapid procalcitonin test, scrub typhus igm rapid test kit, serum ferritin elisa kitkit of 96 tests, vdrl rpr rapid card ict based, vdrlantigen rpr latex pkt of 1 x 5 ml, mac elisa for dengueigm 96 test kit, haematology thiazin stain concentratedilutes in 500 ml when prepared pack of 200 ml, haematology reagent a buffer ph 6 point 8 concentratedilutes in 5 ltrs when prepared pack of 30 ml, haematologyeosin stain concentrate dilutes to 500 ml when preparedpack of 220 ml, haematology aeroix additive for meohpack of 135 ml, occult blood test rapid, multistix r 10sg, keto diastix bott of 50 strips, ready to use leishmanstain with buffer

Central Government/Public Sector

TRN :35669795 | 07 Nov, 2025

Tender Value : 10.30 Lacs

Aizwal - Mizoram

Tender for 62 1 1 alcian blue, alpha naphthol, ammonium sulphate, barfoeds reagent, benzoic acid, disodium edta, disodium hydrogen, eosin powder, haematoxylin powder, methyl orange, motility test, phenylhydrazine, phosphomolybdic acid, potassium iodide pure, sodiumacetate, sodium dihydrogen, sodium phosphate, sodiumthiosulphate, sodium tungstate, tris amino, sodiumcitrate, absolute alcohol, acetic acid, albumin kit, alkaline copper, alkaline phosphatase, afp, amylase ki, benedict qualitative, bials reagent, bicarbonate kit, bilirubin kit, calcium ocpc kit, cea, chloroform, cholesterol kit, ck-mb kit, creatinine kinase kit, creatinine kit, deionized water, drabkins reagent, eamodified, elyte 3 kit, eosin y, eosinophil diluting fluid, esbachs reagent, estrogen, ethylene glycol, fast green, formaldehyde, gamma glutamyl, giemsa staining solution, glucose, glycerin, glycosylated haemoglobin, gordon-mcleod reagent, gram stain kit, hdl-cholesterol kit, hydrochloric acid, iodine mono chloride, iodine solution, lactate dehydrogenase ldh, ldldirect kit, leishmanstain kit, lithium carbonate, magnesium kit, methanol, methylene blue solution, millons reagent, molischsreagent, methyl violet, mayers hemalum, periodic acidsolution, phosphorous kit, phosphotungstic acid, plateletdiluting fluid, progesterone, prostrate specific antigen psa, rapid pap stain kit, ptah stain kit, stable peroxidesubstrate, rectified spirit, schiff solution, seliwanoffsreagent, sgot kit, sgpt kit, sodium hypochlorite, sudanblack solution, sulfuric acid, sulphosalicylic acid, testosterone, tsh, thyroxine t4, tollens reagent, totalprotein kit, triglycerides kit, triiodothyroxine t3, trisbuffer, urea kit, uric acid kit, wbc diluting fluid, zn stainkit, anti hcv elisa test kit, coagulas plasma, distilledwater, hbsag elisa test kit, hiv elisa test kit

State Government

TRN :35653275 | 05 Nov, 2025

Tender Value : 0

Latur - Maharashtra

Tender for supply medicine, surgical and chemical kits items - tab.amitriptyllin 25mg tab.amlodipin 5mg cap.amoxycillin 500mg tab.amoxy 500+clavulanic acid 125 tab.ascorbic acid 100mg tab.aspirin 75mg tab.atenelol 50mg tab.atrovastatin 10mg tab.azithromycin 500mg tab.calcium lactate +vit d3 tab. carbamazepine 200mg tab.cetrizine 10mg tab. ciprofloxacin 500mg tab.clonazepam 0.5 mg tab.diclofenac sodium 50mg cap.doxycyllin 100mg tab.escitalopram 10mg tab.fluconazole 150mg tab.frusemide 40mg cap.iron & folic acid (ferofolla) tab. itroconazole 100mg tab. ivermectine 12mg tab. isorbitrate 10mg tab. labetalol 100mg tab. lorazepam 2mg tab.metformin 500mg tab.metronidazole 400mg tab.misoprostal 200mcg cap. multivitamin tab. nefidepin 10mg tab.norflox 400mg tab.olenzapine 5mg tab.pantoprazole 40 mg tab.paracetamol 500mg tab.phenytoin sodium 100mg tab.prednisolone 5mg tab. sertaline 100mg tab.salbutamol 4mg tab.sodium valproate 200mg tab.trihexyphenidyl +trifluperazine tab.clopidogrel 75mg tab.glimipride 1gm (inj. & iv ) adrenaline bitartrate inj 1 mg/ml adenosine inj. amikacin inj 500mg 2ml amiodarone injection amoxycilline with clavulanic acid inj 1.2 gm anti rabies serum 1500iu inj anti rh d inj 300 mcg anti rabies vaccine 1ml atracurium 2.5ml asyclovir 500mg inj. atropine inj 1ml inj. asvs bupivacaine + dextrose 4ml butrophenol inj buprenorphine inj caffiene inj. calcium gluconate 10ml carboprost 250mcg cefotaxime 1gm injection clindamycin 600mg injection colisthimithate 10lakh iu inj. dexamethazone inj 2ml dexmedetomidine inj deriphylline 2ml inj. diclofenac sodium 1 ml injection diclofenac sodium 3 ml injection diltiazem injection diazipam inj dobutamine 5ml inj dopamine 5ml inj. drotavarine 40mg frusemide inj 2ml gentamycin inj glycopyrrolate inj 1ml haloperidol inj. heparin 25000iu inj. hyluronidase 1500iu inj. hydrocortisone sodium succinate inj 100mg hepamerz inj. human actrapid insuline 10ml iron sucrose 5ml ketamine inj. labetalol 20mg, 4ml inj low molucular heparine 0.6ml lignocaine hydrochloride 2% 30ml lignocaine with adrenaline(1:80000) 30ml levetiracetam 500mg inj lorazepam inj loxicard 4% 50ml inj. magnesium sulphate inj 2 ml menadione sodium bisulphite inj 1ml (vit k) mephentermine inj 10ml meropenum 1gm inj inj. methyl prednisolone 500mg(iv use) midazolam 10ml mucinac (n-acetyl cysteine) neostigmine inj 1ml noradrenaline 2ml inj. nitroglycerin octriotide 100mg inj ondonsetron 2mg inj. oxytocin 5iu/ml 1ml pantoprazole 40mg inj pentazocine lactate inj 1ml inj. phenobarbotone phenaramine maleate inj 2ml phenytoine sodium inj 2ml piperacillin sodium 4gm + tazobactam inj potassium chloride inj 10ml pralidoxime chloride inj 500gm promethazine hcl inj propofol 10ml inj. ropivcaine 20ml. rituximab 500mg/50ml injection sodium bicarbonate 10ml sodium valporate inj. streptokinase 15lac inj. succinyl choline tetanus immunoglobuline 500iu inj. tetanus toxoid 5ml tetanus toxide 0.5ml tramadol 50mg inj. tranexamic acid inj thiamine inj. valenthamide bromide inj vancomycine 1gm inj. vecuronium 4mg inj. iv human immunoglobulin 5%, 100ml iv human albumin 20% hepatetis b immunoglobulin 100iu iv amino acid 500ml iv fat emulsion 250ml iv sodium chloride 0.9% 500ml iv sodium chloride 0.9% 100ml iv ringer lactate 500ml iv dextrose with sodium chloride 500ml iv ciprofloxacin 100ml iv metronidazole 100ml iv manitol 100ml iv linezolid 200mg/100ml inj. suggamadex(inj. reversal) iv glycine irrigation solutin 3liter iv sodium chloride solution 3liter jar iv livofloxacin 500mg/100ml iv paracetamol 100ml (liquid and orals)amoxy+potacium clavunic oral susp. 30ml antacid syrup betadine povidone iodine 5% solution 500ml budesunide respulses 0.5mg 2ml calamine lotion calcium phospate + vitd3 syp. 200ml carboxymethyl cellulose eye drop 10ml cetrizine syrup 30ml ciprofloxacin + dexamethazone e/d ciprofloxacin eye/ ear drop clobetasol ointment 30gm clotrimazole cream 15gm dinoprostone gel 30gm desflurane liquid 240 flurbiprofen eye drop 5ml formaldehyde solition 400ml glycerin ip hydrogen peroxide 100ml hydrogen peroxide+ silver nitrate 1 ltr. (sanishield) lignocaine jelly 2% 30gm liquid parafine 500ml liquid sevoflurane 250ml lulliconazole ointment magnesium sulphate 400gm miconazole nitrate cream 2% 15gm moxifloxacin eye drop 5ml multivitamin syrup paediatric o-d spirit 1000ml ondensetron oral solution paracetamol syrup 60ml polymeric biagonide 1000ml (sanihygen) potasium permagnate (kmno4) powder povidone iodine ointment 15gm sanidex opa 5 ltr jar saniquid -m 20 handwash saniquid-p/ benzalconium 500ml saniscrum -m silver sulphadiazine cream sodium hypochlorite 200ml sodium hypochlorite 5ltr. jar (medichlore) surgical spirit 500ml wax solvant ear drop 5ml zinc sulphate syrup 60ml proparacain eye drop 0.5% 5ml tropicamide + phenylephrine eye drop tropicamide eye drop 5ml silver sulphadiazine ointment 250gm framycetin sulphate cream 30gm surfuctant 3ml vial duoline respulses duphilac syp. (suture, sergical and dressing material)absorbent cotton wool i.p packet of 500 gm net bandage cloth as per schedule fii of drugs and cosmetics act 1940 than of 100cm x 20 mtrs. absorbent gauze cloth as per schedule f-ii of drugs and cosmetics act.1940 than of 90cm x 18 mtrs mask triple layer face (disposable) intravenous infusion set adult urine bag 2000 ml disposable catheter foleys self retaining 2 ways size-8fr catheter foleys self retaining 2 ways size-10fr catheter foleys self retaining 2 ways size-12fr catheter foleys self retaining 2 ways size-14fr catheter foleys self retaining 2 ways size-16fr catheter foleys self retaining 2 ways size-18fr disposable insulin syringe u-40/1 ml each disposable syringe sterile with needle 2 ml disposable syringe sterile with needle 5 ml disposable syringe sterile with needle 10 ml disposable syringe sterile with needle 50 ml elastic adhesive bandage with adhesive mass (ip/usp/bp.) weight nlt (not less than) 145 gsm % stretch-not less than 75%, % regain ?not more than 65% size 10 cm x 4 mtrs cannula intra venous with needle in cannula i.p. with injection port, with wings size-18g cannula intra venous with needle in cannula i.p. with injection port, with wings size-20g cannula intra venous with needle in cannula i.p. with injection port, with wings size-22g cannula intra venous with needle in cannula i.p. with injection port, with wings size-24g cannula intra venous with needle in cannula i.p. with injection port, with wings size-26g cannula intra venous with needle in cannula i.p. with injection port, with wings size-23g cannula intra venous with needle in cannula i.p. with injection port, with wings size-27g catheter suction disposable size-8fr catheter suction disposable size-10fr catheter suction disposable size-12fr catheter suction disposable size-14fr catheter suction disposable size-16fr catheter suction disposable size-18fr gloves latex examination size-medium gloves latex examination size-large gloves rubber sterile, powder free isi mark size-6.5 inch gloves rubber sterile, powder free isi mark size-7 inch gloves rubber sterile, powder free isi mark size-7.5 inch plastic gloves disposable ryles tube sterile disposable size-14fr ryles tube sterile disposable size-16fr ryles tube sterile disposable size-18fr sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-3 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-3.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-4 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-4.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-5.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-6.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-7 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-7.5 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-8 mm id sterile disposable endotracheal tube cuffed/plain pvc transparent for adult use size-8.5 mm id infant feeding tube no. 7 infant feeding tube no. 8 plaster of paris bandages (ready made) size 15 cm x 2.7 m plaster of paris bandages (ready made) size 20 cm x 2.7 m adhesive tape cloth based with porous and hypoallergenic adhesive mass having uniform spiked impression size 10cm x 5mtr mask oxygen (adult) mask oxygen (paediatric) mask nebulizer adult mask nebulizer paediatric diaper adult disposable cap surgeon disposable evacuated tubes k2 edta with double cap 2 ml clot activator double cap non vacuum 4.0 ml (13 mm x 75 mm) evacuated tubes 3.2% buffered sodium citrate with double cap 2 ml tubes non vacuum disposable hiv kit autoclave indicator strip (label) pack of 100 lables (2.5 cm x 6 cm) oxygen nasal cannula adult oxygen nasal cannula neonatal rubber makintosh colour :green,blue, red, thickness-0.4mm, width 110cm. roll of 30 meters i.s.o. certified, isi markwidth cord clamp sterile biomedical waste container red colour 60 ltr. biomedical waste container yellow colour 60 ltr. biomedical waste container blue colour 60 ltr. biomedical waste container black colour 60 ltr. biodegradable bio medical waste bags colour red size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour yellow size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour blue size 33inch x 36inch 51 micron (per kg) biodegradable bio medical waste bags colour black size 33inch x 36inch 51 micron (per kg) airway plastic latex free size 3 airway plastic latex free size 4 airway plastic latex free size 5 dial flow regulator extension set venous extension line with 3way size-10cm venous extension line with 3way size-25cm venous extension line with 3way size-50cm venous extension line with 3way size-100cm venous extension line with 3way size-150cm j r circuit bain circuit adult ecg electrodes for adult ecg/ultrasonography jelly 250 ml central venous catheter kit size- 7 f x 16 cm type- triple lumen oxygen flow meter with rotameter & humidifier bottle abdominal drain kit 28 abdominal drain kit 30 abdominal drain kit 32 a.v.fistula needle set size 17g x 1 epidural anaesthesia set 16g epidural anaesthesia set 18g blood administration/ transfusion set drape disposable poly plain sheet 100cm x 150cm appron plastic disposable romovac drain set 12 f romovac drain set 14 f romovac drain set 16 f romovac drain set 18 f bactigauze (chlorhexidine gauze dressing) pack of 10 piece size- 10 cm x 10 cm picc line 22 colostomy bag dialyser adult hemodialysis tubing set lma [i gel] 3 lma [i gel] 4 lma [i gel] 5 bone wax (pack of 12 piece) collagen dressing 15cm x 30 cm (per piece) surgicel original 4 in x 8 in (12/box) skin stapler multidirectional 35 wides minivac drain 8 f minivac drain 10 f sideport 15 dg crescent 2.5 mm eye drape 70 cm x 70 cm (pack of 10) keratome blade 2.8 mm (chemical, diagnostic kits) glucose total bilirubin direct bilirubin sgot sgpt alkaline phosphatse total protein albumin urea creatinine total cholesterol triglycerides ldl cholesterol hdl cholesterol uric acid csf protein (microprotein) calcium phosphorus magnesium amylase lipase ckmb ldh ise module reagent na+/k+/cl-/li+ xl multical erba auto wash kit xl auto wash (a/al) erba norm erba path tubing kit pm kit h 360 dil-1 1 x 20 liters h 360 lyes- 3 x 500 ml elite h clean- 4 x 50 ml h-360 control l, n, h h-360 calibrator aspen ds diluent aspen m-6ld lyse aspen m-6fd dye aspen m-6lh lyse aspen m-6ln lyse aspen m-6fn dye aspen probe cleanser hbsag elisa kit (+10) hiv elisa 4 th gen.kit hcv elisa kit vdrl rpr kits (+10) antisera blood grouping kit abd igm (monoclonal) 3 x 10 ml denguecombo rapid test card hbsag rapid test card (antigen detection) (+10) abg cassette/strip calibration gas epoc bgem test card (pack of 25) syringe with needle 3 ml thermal roll 57 mm tsk gel b-thala his g8 filter element g8- thalassemia elution buffer kit hemolysis and wash solution (l) g 8 hemoglobin f & a2 control g 8 hemoglobin f & a2 calibrator ribbon, ebar printer bluing reagent hematoxylin 10x ssc solution, 2 l label, blank, flap, 540 roll lcs reaction buffer concentrate (10x) 10x ez prep solution, 2 l cell conditioning solution, cc1, 2l ultra view universal dab detection kit confirm anti-cd99 mouse mono confirm cytokeratin 20 rabit mono confirm anti-desmin (de-r-11) pab ventana anti-e cadherin (36) confirm cytokeratin 7 rabbit mono confirm anti-s100 (4c4.9) primary antibo ventana anti-p63 (4a4) mouse mono matrix gel card ahg (144 test) matrix liss solution (500 ml) uniplastin for prothromine time itinr cuvette formalin solution (37 to 40 %) xylene (sulpher free) micropipette tips 200 ul ethanol absolute alcohol paraffin wax confirm anti- pr (1 e2) confirm anti- er (sp1) pathway anti-her2/neu (4b5) rabbit mono confirm anti-ki-67 (30-9) rabbit monoclo confirm anti-p67 (d0-7) primary antibody lohexol dye 100ml

Central Government/Public Sector

TRN :35645938 | 04 Nov, 2025

Tender Value : 0

Hyderabad - Telangana

Tender for gem bids for nitrile coated/nitrile hand gloves (v2), elisa test kits (v2), anodized aluminium frame, high end desktop computer, bod incubator, multipara monitor - low end, entry and mid level desktop computer, xlpe cable for working voltages up to and including 1.1 kv as per is 7098 (part 1), microscopes - pathological and research as per is 4381, is 5204, is 4381, is 5204, foot operated pedal bin or bucket for bio - medical waste collection

Central Government/Public Sector

TRN :35631048 | 05 Nov, 2025

Tender Value : 21.34 Lacs

Nainital - Uttaranchal

Tender for gem bids for anti rainbow trout oncorhynchus mykiss atlantic salmonsalmo salar igm monoclonal antibody lyophilized proteinprepared from bovine free tmb elisa substratesolutionsturbo250 ml per pack bovine serum albuminbsa protease free fatty acid free ph 7 0 50 grams per pack goat anti mouse igg h l secondary antibody hrpconjugated lyophilized polyclonal 2ml per vial hydroxylamine hydrochloride hi ar acs n 1 naphthylethylenediamine dihydrochloride hi ar acs nedd 2phenoxyethanol vanadium iii chloride sodium nitrite sodium nitrate hi lr hydrochloric acid concentrated sodium hypochlorite hi ar acs 4 w v solution ezassaytbars estimation kit for lipid peroxidation 100 reactions ezassaytm reactive oxygen species assay kit frap 200tests agarose low melting field test kit dneasy bloodand tissue kit 50 50 dneasy mini spin columns proteinasek buffers collection tubes 2 ml hematoxylin solution500ml eosin y solution 0 5 alcoholic 500ml histosec 60pastilles without dmso oxolinic acid iodophor chloramine t trihydrate potassium permanganate bhuvision soil nutrient analysis code hg bsna 100 test clearserological pipette 10ml amber glass vials ermamicrotome blades 1 2 propanediol 2 5l erlenmeyerconical flask multi port hplc cap micropipette weigert s iron hematoxylin kit 2x500ml eosin y 5g alcianblue 8gx 10g d p x 100ml paraplast plus 1kg 30acrylamide bis solution 29 1 l thick blot filter paper precut prestained protein ladder methanol glycerol biotin dsorbitol g418 disulfate salt potassium phosphate dibasic potassium phosphate monobasic ptriex 4 neo dnanovagen amicon ultra centrifugal filter 10 kda mwco ampicillin sodium salt imidazole dmso protease andphosphatase inhibitor cocktail tmb enhanced one bid number gem2025b6792045 dated 15-10-2025 bid document1 93 0 0 component hrp membrane substrate, 3 3diaminobenzidine, ammonium persulfate, cobalt iichloride, yepd broth granulated 500g, ypd yepd growthagar 500g, ypd yepd growth medium, yeast nitrogenbase ynb w ammonium sulphate 100g, peptone 500g, yeast extract powder, l histidine, dextrose anhydrous hiar acs, l glutamic acid, l methionine, l lysine hi lr, lleucine, l isoleucine, 10x tris glycine sds gel runningbuffer, 2 5x tris sds buffer ph 8 8, 5x tris sds buffer ph 68, 10x transfer buffer, 5x laemmli buffer, 50x tae, rnaisolation, sedgewick rafter counting chamber cell, borosilicate bod bottles, borosilicate dissolved oxygenbottles, uniflo 13mm 0 2 pes s 100 pk, uniflo 13mm 045 pes s 100 pk, uniflo 25mm 0 45 pes s 45 pk, uniflo25mm 0 2 pes s 45 pk, single tubes pcr 0 2 ml transparentwith attached flat cap, microcentrifuge tubes pp 0 5 ml withattached cap with lid closure, microcentrifuge tubes pp 1 5ml with attached cap with lid closure, microcentrifuge tubespp 2 0 ml with attached cap with lid closure, microcentrifuge tubes pp 5 ml transparent, mueller hintonagar granulated 500g, mueller hinton broth 500g, glucose yeast extract agar 500g, glucose yeast extractacetate broth 500g, agar granulated bacteriological grade500g, nutrient agar granulated, nutrient broth granulated, d glucose anhydrous, sodium chloride, xylene forhistopathology 2 5l, resazurin sodium salt 5g, z 2 cl osu100g, mtt 1g, n phenyl 1 naphthylamine 500g, propidium iodide, wizard genomic dna purification kit 100isolations x 300ul, wizard sv gel and pcr cleanup system50 prep, hepes molecular biology grade free acid 100g, disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg, petridish, centrifuge tube conical bottom with lid, selfstanding centrifuge tube with lid, cryovial with externalthreaded self standing sterile, cryo box pp, rack for microtube l, rack for micro tube, universal tube rack pp, universal tube rack, 20c mini cooler with gel filled cover, 0c mini cooler with nontoxic gel, agar powderbacteriological grade, mueller hinton agar, mueller hintonbroth, tryptone soya broth soyabean casein digestmedium, tryptone soya agar casein soyabean digest agarsoyabean casein digest agar, steriswift disinfectant wipes, polyethylene glycol mw 6000, sterile cotton swab, 2 10ulaerosol barrier gentip, 20 200ul aerosol barrier gentip, 100 1000ul aerosol barrier gentip, wrappup alluminiumfoils, biosoft tissue, kimwipes, kimberly clark, ecosafedisinfectant, centrifuge tube, petri dish, syringe

Central Government/Public Sector

TRN :35610475 | 03 Nov, 2025

Tender Value : 16.98 Lacs

Nainital - Uttaranchal

Tender for custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5

Related Searched Keywords : elisa test kit

List of elisa-test-kit Tenders

Tender for gem bids for hcv elisa test kits q2

Get elisa test kit Tender Alert...

Related Searched Keywords : elisa test kit

State Tenders »

City Tenders »

Keyword Tenders »

Sector Tenders »

Ownership Tenders »

Indian Segment

Browse Tenders

Global Segment

Others

Get in touch with us